ID: 969026237

View in Genome Browser
Species Human (GRCh38)
Location 4:4174994-4175016
Sequence TTGGATGTCCACAACCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969026235_969026237 4 Left 969026235 4:4174967-4174989 CCTGCATAGGAGATGACTGCTGT No data
Right 969026237 4:4174994-4175016 TTGGATGTCCACAACCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969026237 Original CRISPR TTGGATGTCCACAACCATCT TGG Intergenic
No off target data available for this crispr