ID: 969032594

View in Genome Browser
Species Human (GRCh38)
Location 4:4226727-4226749
Sequence CGGAATCCCCGGCCCCCCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 5, 2: 0, 3: 8, 4: 93}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969032594_969032605 1 Left 969032594 4:4226727-4226749 CCGCCGGGGGGCCGGGGATTCCG 0: 1
1: 5
2: 0
3: 8
4: 93
Right 969032605 4:4226751-4226773 GGACCTCGGGGCCGAGGACGAGG 0: 1
1: 0
2: 2
3: 18
4: 186
969032594_969032606 2 Left 969032594 4:4226727-4226749 CCGCCGGGGGGCCGGGGATTCCG 0: 1
1: 5
2: 0
3: 8
4: 93
Right 969032606 4:4226752-4226774 GACCTCGGGGCCGAGGACGAGGG 0: 1
1: 0
2: 2
3: 11
4: 90
969032594_969032608 5 Left 969032594 4:4226727-4226749 CCGCCGGGGGGCCGGGGATTCCG 0: 1
1: 5
2: 0
3: 8
4: 93
Right 969032608 4:4226755-4226777 CTCGGGGCCGAGGACGAGGGAGG 0: 1
1: 1
2: 6
3: 14
4: 221
969032594_969032603 -5 Left 969032594 4:4226727-4226749 CCGCCGGGGGGCCGGGGATTCCG 0: 1
1: 5
2: 0
3: 8
4: 93
Right 969032603 4:4226745-4226767 TTCCGGGGACCTCGGGGCCGAGG 0: 1
1: 0
2: 1
3: 14
4: 129
969032594_969032611 20 Left 969032594 4:4226727-4226749 CCGCCGGGGGGCCGGGGATTCCG 0: 1
1: 5
2: 0
3: 8
4: 93
Right 969032611 4:4226770-4226792 GAGGGAGGCGAGCAGGCCGCTGG 0: 1
1: 5
2: 2
3: 46
4: 474
969032594_969032610 13 Left 969032594 4:4226727-4226749 CCGCCGGGGGGCCGGGGATTCCG 0: 1
1: 5
2: 0
3: 8
4: 93
Right 969032610 4:4226763-4226785 CGAGGACGAGGGAGGCGAGCAGG 0: 1
1: 1
2: 1
3: 18
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969032594 Original CRISPR CGGAATCCCCGGCCCCCCGG CGG (reversed) Exonic
903950532 1:26993770-26993792 CGGCATCCCCCGCCCCCCACCGG - Exonic
906960911 1:50419085-50419107 AGGCAGCCCAGGCCCCCCGGCGG + Exonic
907689220 1:56645546-56645568 CGGGAGCCCCGGGCCTCCGGCGG + Intronic
913963153 1:143354336-143354358 CGGAGTCCCCGGCCCCCCGGAGG + Intergenic
914057509 1:144179922-144179944 CGGAGTCCCCGGCCCCCCGGAGG + Intergenic
914121637 1:144786444-144786466 CGGAGTCCCCGGCCCCCCGGAGG - Intergenic
920184628 1:204152179-204152201 CGGCGTCACCGGCCCCCAGGGGG - Intergenic
1062767486 10:76538-76560 CCGAAGCCCCGGCCCCTCCGGGG + Intergenic
1077043919 11:536026-536048 CGGACCCCGCGGCCACCCGGGGG - Intronic
1077144109 11:1037143-1037165 CTGAATCCCAGGACCCCCTGAGG + Intergenic
1077250063 11:1557011-1557033 CGGCGGCCCCGGCCCCCCGCCGG - Exonic
1077317169 11:1924807-1924829 GGGAATACCAGGCCCCCAGGAGG + Intronic
1077555592 11:3224521-3224543 CGGAATCCTCTGTCCCCTGGTGG - Intergenic
1081718323 11:45267455-45267477 CAGATTCCCAGGCCCCCCAGAGG + Intronic
1081845520 11:46238098-46238120 CGGCATCTCCGGCCTCCCCGCGG + Intergenic
1081873104 11:46392023-46392045 CGGACACCCCCACCCCCCGGAGG - Intergenic
1083186712 11:61021926-61021948 AGGAATCCCCCGCCACCCTGGGG - Intergenic
1084325903 11:68399932-68399954 CAGAATCCCAGGGCACCCGGTGG - Intronic
1084524214 11:69685926-69685948 CCGAGTCCCCGGCCCCGCGCGGG + Intergenic
1084621243 11:70271233-70271255 CGGAAGCCCCGAACCCCGGGGGG - Intronic
1097267756 12:57755616-57755638 CCGCCTCCCCGGCCCCCCCGGGG - Exonic
1097777928 12:63669151-63669173 CGGAACCGCCGGCCCGCCGGCGG + Intergenic
1098161193 12:67649205-67649227 CCGCATCCCCGGACCCCCGCCGG + Intronic
1104602343 12:130162304-130162326 CGGGCTCCCGGGCCCCGCGGGGG - Intergenic
1104642903 12:130478847-130478869 AGGGATCCCCGGCCCACCCGTGG + Intronic
1114265222 14:21069719-21069741 GGGATTCCCCAACCCCCCGGGGG - Intronic
1126113323 15:45187846-45187868 CCGCACCCCCGGCGCCCCGGCGG + Intronic
1129690417 15:77710132-77710154 CGGCAGCCCCTGCCCCCCTGGGG - Intronic
1131249111 15:90819301-90819323 CGGGATCCACGGCCCCACAGAGG + Intergenic
1131249141 15:90819395-90819417 CGGGATCCACGGCCCCACAGAGG + Intergenic
1132885411 16:2180115-2180137 CCGACTCCCCAGGCCCCCGGCGG + Exonic
1132975565 16:2709650-2709672 TGGACTCCCCGCCCCCCCGCAGG + Intergenic
1136459444 16:30400508-30400530 CGGATTTCCCGGCGCCCCGCGGG + Intergenic
1136540208 16:30924327-30924349 CGGGGTCCACGGCCCCCCGAGGG - Intronic
1136544662 16:30948511-30948533 GGTAAGCCCCGGCCCCCCGGAGG - Exonic
1136913689 16:34162744-34162766 GGGAATCCCCGGGCGCCCGTGGG + Intergenic
1136993286 16:35170253-35170275 CGGGGTCCCGGGCCCCGCGGCGG - Intergenic
1140915724 16:79491568-79491590 TGGTATCCCCTGCCTCCCGGTGG + Intergenic
1142231251 16:88901272-88901294 AGGAAGCCCAGGCCCCCCGGAGG + Intronic
1143483364 17:7239312-7239334 CGGGATCCCCGGCTCCGGGGAGG - Exonic
1145280571 17:21464244-21464266 TGGAATCCCCAGCCGCCCGCCGG - Intergenic
1146488128 17:33260552-33260574 CGTATTCCCCGCCCCCCTGGCGG - Intronic
1152378484 17:79930395-79930417 CGGAGCCCCCGGCCCACCTGAGG - Intergenic
1152683928 17:81684362-81684384 CCGAATGCCCGGGCCCGCGGAGG - Intronic
1152960321 18:75884-75906 CCGAAGCCCCGGCCCCTCCGGGG + Intergenic
1160157513 18:76444743-76444765 CAGAATCCCCGACCCCCGTGGGG - Intronic
1160430734 18:78810892-78810914 CAGAATCGCCGAGCCCCCGGCGG + Intergenic
1161145855 19:2677710-2677732 TGGAATCCCCTAACCCCCGGGGG + Intronic
1161250097 19:3275808-3275830 CCGAGTCCCCGGCCTCCGGGAGG - Intronic
1161337136 19:3720737-3720759 CGGAATCCCAGGCCCCTGAGCGG + Intronic
1162378293 19:10317636-10317658 GGGAAGCCCCGGCCCCCCAGCGG - Intronic
1162954668 19:14091228-14091250 CGGCAGCCCCGGCCCGCGGGCGG - Intergenic
1163157889 19:15449289-15449311 GGGAATCCCCAGGCCCCCGAGGG - Intronic
1163690380 19:18735406-18735428 CAGGATCCCCCGCTCCCCGGGGG - Intronic
1166090325 19:40504136-40504158 CCGCATCCCCGCCCCCCCGCCGG - Intronic
1166529356 19:43533486-43533508 CGGAAGCCCCGCCCCCGGGGAGG + Exonic
1166853011 19:45769293-45769315 CGGAATTCCCGGCTCCGCAGGGG + Intergenic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
1168721777 19:58558407-58558429 CGGGGTCCCGGGCCCCGCGGCGG - Exonic
1202696993 1_KI270712v1_random:132595-132617 CGGAGTCCCCGGCCCCCCGGAGG + Intergenic
929501317 2:42493716-42493738 AGGACTCCCCGGCCACCCGCAGG - Exonic
929539929 2:42811363-42811385 CTGATTTCCCGGCCCCCGGGAGG - Intergenic
934278154 2:91589609-91589631 CGGAGTCCCCGGCCCCCCGGAGG + Intergenic
942447587 2:176088341-176088363 CGCAATCCCGCGCCCCACGGAGG + Intergenic
942653844 2:178194752-178194774 CGGGGTCCTCGGCCCGCCGGAGG - Intronic
947549653 2:231037430-231037452 CGGACCCCCGGGCCCCCGGGCGG - Intergenic
948462101 2:238134719-238134741 CGGAATCTACAGCACCCCGGAGG + Intergenic
1173741840 20:45407028-45407050 TGGGCTCCGCGGCCCCCCGGGGG + Intronic
1175832026 20:61969948-61969970 CGGAACACTCGGCCCCCCGTCGG + Intronic
1175956040 20:62609933-62609955 CGGCATCCCGGGCCCCTCGCTGG - Intergenic
1180699497 22:17773945-17773967 CGGAATCCCCGCCCACACCGTGG - Exonic
1181054875 22:20256171-20256193 CGGACTGCCCCGCCTCCCGGAGG - Intronic
1184276185 22:43411095-43411117 TGGAATCCCCGTCCCACCCGCGG + Intergenic
1184860951 22:47173107-47173129 CTGAATCCCCTGCCCCTCAGGGG - Intronic
1185119082 22:48955049-48955071 AGGGAGCCCTGGCCCCCCGGAGG - Intergenic
953923966 3:46971341-46971363 CAGAATCCCCTTCCCCCAGGGGG + Intronic
954627753 3:52031977-52031999 CAGACCCCCCAGCCCCCCGGCGG + Intergenic
962820685 3:139044931-139044953 CGCAATCCTCTGCCCCCTGGAGG + Intronic
964344663 3:155744232-155744254 GGCAAACCCCGGCCCCGCGGCGG - Intronic
969032594 4:4226727-4226749 CGGAATCCCCGGCCCCCCGGCGG - Exonic
969569847 4:8001862-8001884 TGGAATCTCCTGCCCCCCGATGG + Intronic
979674779 4:123398686-123398708 CAGAAGCCGCGGCCCCCAGGGGG - Intronic
995623870 5:114056073-114056095 CCGAATCCCAGGCGCCCCGCCGG - Intergenic
998658167 5:144205444-144205466 CGGAGCCCCGGGCCCCCCGCCGG + Exonic
1002093610 5:176818247-176818269 CGGAAGCCCCGGCCTGCAGGAGG - Intronic
1007614277 6:43171366-43171388 CAGCAGCCCCTGCCCCCCGGGGG + Exonic
1018837310 6:167494690-167494712 AGGAACCCCCTGACCCCCGGAGG + Intergenic
1022120447 7:27303073-27303095 CAGGATCCCTGGCTCCCCGGTGG + Intergenic
1022936858 7:35186824-35186846 CGGAACCGCTGGCCCGCCGGTGG + Intergenic
1028373262 7:90118764-90118786 CGGAACCGCCGGCCCGCCGGTGG - Intergenic
1029390755 7:100272336-100272358 CGGTAGCTCCGGCCGCCCGGCGG - Intergenic
1029640766 7:101817449-101817471 CGGAGTCCCCGGCGCCGCGGGGG + Intronic
1029833092 7:103280923-103280945 CGGAACCGCCGGCCCGCCGGTGG + Intergenic
1033146127 7:138871276-138871298 CAGGATCTCCCGCCCCCCGGAGG - Exonic
1034991030 7:155548344-155548366 CAGAATCCCGGGCCCACAGGTGG + Intergenic
1035361411 7:158316102-158316124 CGGAACCACCTGCCCCCCGGCGG - Intronic
1035627274 8:1080307-1080329 AGGAAAGGCCGGCCCCCCGGAGG - Intergenic
1041693629 8:60714176-60714198 GGGGATGCCCCGCCCCCCGGGGG - Intronic
1045738229 8:105319800-105319822 CGGGACCCCCGGGCACCCGGGGG - Intronic
1049400557 8:142424873-142424895 CAGAGTCCACGGCCCCCAGGAGG + Intergenic
1049409183 8:142464872-142464894 CGGGACCCCTGGCCCCCCGCGGG + Exonic
1049657326 8:143804622-143804644 CGGCAACCCAGGCACCCCGGGGG + Exonic
1049665655 8:143841401-143841423 CCAAATCCCCGCCCCCTCGGAGG + Intergenic
1053198443 9:36136985-36137007 CGCGATCCCCGGCTCTCCGGCGG - Intronic
1059271270 9:113071646-113071668 CAGGAACCCGGGCCCCCCGGTGG - Intergenic
1061411297 9:130423297-130423319 AGGAATCCCTGGCCCCTCGTGGG + Intronic
1191256662 X:58282468-58282490 GGGACTCCCCGACCCCCCAGGGG + Intergenic