ID: 969037558

View in Genome Browser
Species Human (GRCh38)
Location 4:4267008-4267030
Sequence GGCCTGTGACTGGAAGCGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969037558_969037564 17 Left 969037558 4:4267008-4267030 CCTCTCGCTTCCAGTCACAGGCC No data
Right 969037564 4:4267048-4267070 CACTGACAAACTCGTCTCTTTGG No data
969037558_969037565 24 Left 969037558 4:4267008-4267030 CCTCTCGCTTCCAGTCACAGGCC No data
Right 969037565 4:4267055-4267077 AAACTCGTCTCTTTGGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969037558 Original CRISPR GGCCTGTGACTGGAAGCGAG AGG (reversed) Intergenic
No off target data available for this crispr