ID: 969039122

View in Genome Browser
Species Human (GRCh38)
Location 4:4280935-4280957
Sequence CAGAATAGGTAGCAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 365}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969039122_969039126 24 Left 969039122 4:4280935-4280957 CCTTCCTCCTGCTACCTATTCTG 0: 1
1: 0
2: 0
3: 33
4: 365
Right 969039126 4:4280982-4281004 GTTATACTTCCCAGTGAATTAGG 0: 1
1: 0
2: 0
3: 8
4: 105
969039122_969039127 25 Left 969039122 4:4280935-4280957 CCTTCCTCCTGCTACCTATTCTG 0: 1
1: 0
2: 0
3: 33
4: 365
Right 969039127 4:4280983-4281005 TTATACTTCCCAGTGAATTAGGG 0: 1
1: 0
2: 0
3: 5
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969039122 Original CRISPR CAGAATAGGTAGCAGGAGGA AGG (reversed) Intronic
901045238 1:6392394-6392416 CAGAATCGGAAGCAGCAGGCTGG - Intronic
901506806 1:9690118-9690140 CCGAATAGGGGGCAGGGGGAGGG - Intronic
901738856 1:11329379-11329401 CAGATTTGGTAGCAGGAAGTGGG + Intergenic
901773416 1:11542917-11542939 GAGAAGAGGCAGGAGGAGGATGG - Intergenic
902529285 1:17080117-17080139 CAGATTAGGTAACCTGAGGAAGG + Intronic
902546519 1:17193842-17193864 CAGAAAAGAGAGCAGGAGGCAGG + Intergenic
902676442 1:18011879-18011901 CAGAGTAGGTAGCATGTGGGAGG - Intergenic
903004772 1:20291418-20291440 GAGAAGAGGGAGCAGGAGAAGGG - Intronic
903947458 1:26972656-26972678 CAGAAATGGGAGGAGGAGGATGG + Intergenic
903989200 1:27253438-27253460 GAGAAGAGGAAGGAGGAGGAAGG - Intronic
904158954 1:28507961-28507983 GATGATAGGTAGCTGGAGGAAGG + Intronic
904435016 1:30489258-30489280 CAGAGCAGGTAGCAGCAGTAGGG - Intergenic
904451782 1:30617781-30617803 GAGAATATATTGCAGGAGGAAGG - Intergenic
905058702 1:35121172-35121194 CAGAAGAGGTGGCGGCAGGAGGG - Intergenic
905356424 1:37388113-37388135 CAGTGCAGGTAGCATGAGGAGGG - Intergenic
905388987 1:37624294-37624316 CATAACAGGCAGCAGCAGGAGGG - Intronic
905461941 1:38127831-38127853 CAGAATGGCAAGGAGGAGGAGGG - Intergenic
905651929 1:39662375-39662397 CAGGCTAGGGAGCAGGAGAATGG - Intronic
906686161 1:47764745-47764767 CAGAACAGGGAACAGGAGGCAGG + Exonic
907677609 1:56533027-56533049 CATAATAGGTTGCTGGAAGACGG - Intronic
908000145 1:59671522-59671544 CAGAGTAGGTGGAGGGAGGAAGG + Intronic
908556262 1:65259618-65259640 CAGAACAGGTGGTAGGAGAAGGG - Intronic
908607720 1:65818399-65818421 GACAATAGGAAGAAGGAGGATGG - Intronic
911995730 1:104763525-104763547 AAGAATAGGAAGCAGGAAAAAGG + Intergenic
913548655 1:119895328-119895350 CAGACCAGGTAGCAGGGGCAAGG + Exonic
914350117 1:146833211-146833233 CAGAATATGCAGCTGGAGGTAGG - Intergenic
915321136 1:155057098-155057120 CAGAGTAAGTAGCTGCAGGATGG + Exonic
915593888 1:156885603-156885625 CAGGATAGAGAGGAGGAGGAAGG - Intergenic
916075631 1:161198541-161198563 CACAATGGGGAGCAGGAGGCAGG + Exonic
916602755 1:166308996-166309018 AAGAATGAGTAGCAGGAGCACGG - Intergenic
916691855 1:167197593-167197615 CAGTATGGGTAACAGCAGGAAGG + Intergenic
918316852 1:183329690-183329712 AAGAAAAGGTAGGAGCAGGAAGG - Intronic
919545656 1:198914957-198914979 CAGGGTAGCTAGCAGTAGGAGGG - Intergenic
920109648 1:203578326-203578348 GAGAATAGTTAGCAGGAGGGAGG + Intergenic
920244339 1:204576516-204576538 CAGAGCCGGGAGCAGGAGGATGG + Intergenic
920737942 1:208552241-208552263 GAGAAAAGGAAGCAGAAGGAAGG - Intergenic
920910933 1:210215683-210215705 TAGAGTAGGGAGGAGGAGGAGGG + Intergenic
923010304 1:230083163-230083185 CAGAGTGGGGAGCAGGATGATGG + Intronic
923655057 1:235908815-235908837 CAGAATAGATTGCGAGAGGAAGG - Intergenic
923796832 1:237164854-237164876 CAGAATAGGTATACGGAGTATGG - Intronic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1062969186 10:1633062-1633084 CAGGAGAGGAAGCAGGAGCACGG - Intronic
1064042966 10:11984575-11984597 TAGACTAGGTAGCACGAGGAAGG - Intronic
1064895787 10:20234682-20234704 CAGAATAAGAAGCAGGAAAAAGG - Intronic
1065086040 10:22177870-22177892 CAGAAGAGGAAGCAGAAGAAAGG + Intergenic
1066408197 10:35140410-35140432 CATAATAGGTAGCATGATGAGGG - Intronic
1067097072 10:43308554-43308576 CAGAATGGGCTGCAGGAAGAGGG - Intergenic
1067133040 10:43583576-43583598 CAGAAGAGAAAGCAGGAGAATGG + Intergenic
1067182135 10:43996322-43996344 CAGAAGAGGGTGCAGGAAGAGGG + Intergenic
1067482118 10:46608708-46608730 CAAAAGAGGTAACAGTAGGATGG - Intergenic
1067612631 10:47732959-47732981 CAAAAGAGGTAACAGTAGGATGG + Intergenic
1068216152 10:53984855-53984877 CAGAATAGGAAGTAGAAGAAAGG - Intronic
1068832148 10:61507589-61507611 CAGAAGAGGTAGTGGGAGGCAGG + Intergenic
1069238594 10:66109566-66109588 CAACATAGGTAGCAGGAGTAAGG + Intronic
1069373415 10:67770049-67770071 CAGAAGAGTTCTCAGGAGGAAGG - Intergenic
1070312579 10:75284353-75284375 CAGAAGAGGGAGCAGCAGGCGGG + Intergenic
1071628056 10:87193202-87193224 CAAAAGAGGTAACAGTAGGATGG + Intergenic
1071855027 10:89615430-89615452 CAGGAGATGAAGCAGGAGGAAGG - Intronic
1071984140 10:91033886-91033908 CAGAATAGTTAGCAGCAGCATGG - Intergenic
1072009370 10:91290241-91290263 CAGAGTGGGAAGCAGGAGGAGGG + Intergenic
1072626430 10:97115315-97115337 CAGGATAAGTACCAGCAGGAAGG - Intronic
1072847852 10:98852288-98852310 CAGAAAAGGTAGCAGGTGAAAGG - Intronic
1074548135 10:114417842-114417864 CAAAATACGTAGGAGGAGGGAGG + Intergenic
1074972667 10:118551958-118551980 CAGGATTGGGAGCAGGAGTAGGG + Intergenic
1075163695 10:120046983-120047005 CAGAATTGGCAGCAGGTGGTAGG + Intergenic
1075341265 10:121648440-121648462 CAGACTAGGTAGTAGGAGGCAGG - Intergenic
1077920982 11:6641536-6641558 CAGCAATGGTAGCAGGAGGTGGG + Exonic
1078783596 11:14464119-14464141 CAGAATGGGTTGGAGGATGATGG - Intronic
1079016201 11:16870804-16870826 CAGAAGATATAGCAGGAGAAAGG + Intronic
1080347067 11:31336856-31336878 CATTCTAGGTAGCAGAAGGAAGG - Intronic
1080711983 11:34757643-34757665 CAGGATGGGTAGTAGGAGAATGG + Intergenic
1080823098 11:35825625-35825647 CAGACTAGGTTGCAGGTGGAGGG + Intergenic
1080878909 11:36301198-36301220 CAGAAGAGGGAGGAGGAAGAAGG + Intronic
1080981241 11:37408879-37408901 TAGAAGAGGTGACAGGAGGAAGG - Intergenic
1081180724 11:39983519-39983541 CAGAAGGTGAAGCAGGAGGAGGG - Intergenic
1083254048 11:61485607-61485629 CAGGAGAGGGAGCAGCAGGAAGG - Intronic
1084021021 11:66418359-66418381 CGAAATAGCAAGCAGGAGGAGGG - Intergenic
1084582523 11:70032805-70032827 CAGAACACATAGGAGGAGGAGGG + Intergenic
1085256609 11:75177116-75177138 CACCATAGGGAGGAGGAGGAGGG + Intronic
1085300161 11:75453170-75453192 CAGACTGGGGAGGAGGAGGAAGG + Intronic
1085300322 11:75454600-75454622 CAGACCAGGGAGCAGGAGCAAGG + Intronic
1085656288 11:78318235-78318257 CAGAAGGGCTATCAGGAGGAGGG + Intronic
1086399382 11:86448135-86448157 CATCATAGGTAGGAGGAGGGAGG - Exonic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089294014 11:117457389-117457411 CAGAATAGGAGGCAAGAAGAAGG + Intronic
1089763529 11:120746484-120746506 CAGAAAAGGGGGCTGGAGGAAGG - Intronic
1089801002 11:121027297-121027319 CAGAATGGGTAGCATGAAAAAGG - Intronic
1089817242 11:121187368-121187390 CAAAATAGGTAGGAGCTGGAGGG - Intronic
1091736382 12:2925423-2925445 CAAGAGAGGTACCAGGAGGAAGG + Intronic
1091797449 12:3305419-3305441 CAGAATAGGGAGCAGGGGAGGGG - Intergenic
1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG + Intronic
1092286259 12:7130653-7130675 CAGAAGGGGCAGCAGCAGGAGGG - Exonic
1092785805 12:12025530-12025552 GAGAATAGGTAGCAGGGGCAAGG + Intergenic
1094780118 12:33781508-33781530 CAGAAAAGGTAGCTGGAGAGGGG - Intergenic
1095875284 12:47073918-47073940 CAGAATAGGTAGAATCAGAATGG + Intergenic
1096514760 12:52149717-52149739 CAGGACAGGGGGCAGGAGGAGGG - Intergenic
1096758748 12:53822222-53822244 AAGAAGAGGGAGGAGGAGGAGGG - Intergenic
1096864572 12:54554654-54554676 CAGGATAGGTGGCTGGAGGGAGG + Intronic
1097132214 12:56820347-56820369 AAAAATAGGTAGCAGGATGGTGG + Intergenic
1097420203 12:59368341-59368363 GAGAAAGGGCAGCAGGAGGAAGG - Intergenic
1097811480 12:64023976-64023998 CAGAGGAGGTGGTAGGAGGAGGG + Intronic
1100348724 12:93757746-93757768 AAGAATTGTTAGGAGGAGGAAGG + Intronic
1100574987 12:95882719-95882741 AAGAATGGGTAGAAGGAGAAGGG - Intronic
1102198873 12:111043850-111043872 CAGAAATGGTAGTAGGAGAAAGG + Intronic
1105914324 13:24898441-24898463 CTGAATAGGTGGCCGGAGCAAGG + Intronic
1107136564 13:36950926-36950948 CAGATAAAGTATCAGGAGGAAGG + Intronic
1107697394 13:43013563-43013585 AAGACAAGGTATCAGGAGGAGGG - Intergenic
1108431292 13:50356643-50356665 CACAACAGGCATCAGGAGGAAGG + Intronic
1109103776 13:58222310-58222332 TTGATTAGTTAGCAGGAGGAAGG + Intergenic
1109489043 13:63070779-63070801 CACAATTGGTAGCAGAAGGTAGG - Intergenic
1110047876 13:70854228-70854250 CTGAATAGGTAGAAAGAAGATGG - Intergenic
1110803300 13:79725720-79725742 CAGGATGGGGGGCAGGAGGATGG - Intergenic
1111716767 13:91888140-91888162 CAGAAGATGTAGGAGGAGCAAGG + Intronic
1111868221 13:93796648-93796670 GAGAAAAGGTTGCTGGAGGAAGG - Intronic
1113670902 13:112175475-112175497 CAGAATCTGGAGGAGGAGGAAGG + Intergenic
1113812044 13:113148921-113148943 CGGAACACGGAGCAGGAGGAGGG + Exonic
1114528516 14:23380909-23380931 GAGAACAGGAAGCAGGAGGCAGG - Intergenic
1114895870 14:26990618-26990640 TAGAATAGGGAGAAGAAGGAAGG + Intergenic
1116218056 14:42045678-42045700 AAGAATAAGCAGCAGGAGCATGG - Intergenic
1120387242 14:83862101-83862123 CAGATTAGAAGGCAGGAGGAGGG - Intergenic
1120751697 14:88203904-88203926 CAGGGTAGGTAGCAGGTGGGAGG + Intronic
1121841367 14:97136681-97136703 AAGAATACCTAGCAGGAGAAAGG - Intergenic
1122979496 14:105185260-105185282 CAGAAGAGGGAGCAGGAGGGTGG - Intergenic
1123130487 14:105981745-105981767 AAGAAGAGGAAGCAGGAGGGAGG - Intergenic
1123831801 15:24146894-24146916 CTGAATGGGTAGCAGTAGAAGGG - Intergenic
1123836779 15:24202910-24202932 CTGAATGGGTAGCAGTAGAAGGG - Intergenic
1123846046 15:24303016-24303038 CAGAATGTGTAGCAGTAGAAGGG - Intergenic
1123865083 15:24510727-24510749 CCGAATGGGTAGCAGTAGAAGGG - Intergenic
1125519326 15:40339407-40339429 CAGAATAGTTAGTAGGAGAGGGG + Intronic
1125858832 15:42978367-42978389 CAGAGTAGGTAAAATGAGGATGG + Intronic
1126424349 15:48510638-48510660 CAGAATTGGTATAAGGAAGATGG - Intronic
1126550808 15:49927315-49927337 CAGAAGAGGGAGGAGGAGAAAGG + Intronic
1126921429 15:53529942-53529964 GAGGAAATGTAGCAGGAGGAAGG - Intronic
1126950718 15:53877591-53877613 GAGAATAGGGAGGAGGAGGAGGG + Intergenic
1127616041 15:60686801-60686823 CAGAACAGGTTGGATGAGGATGG + Intronic
1127771950 15:62239463-62239485 CAGAATGGGTCGCTGGAAGAAGG + Intergenic
1128061149 15:64736766-64736788 CTGCAAAGGTATCAGGAGGAGGG - Intergenic
1130196018 15:81780956-81780978 CAGGAAAGGTAACAAGAGGAAGG + Intergenic
1130586863 15:85189948-85189970 CAGCAGTGCTAGCAGGAGGAGGG + Intergenic
1130813451 15:87406044-87406066 CAGAACAGGTTGCAGGAATATGG + Intergenic
1132006285 15:98230380-98230402 CAGCATGGGCAGCATGAGGAGGG + Intergenic
1133110651 16:3546096-3546118 ATGAATAGGAAGCAGGAGGTGGG + Intronic
1133632934 16:7639012-7639034 CTTAATAGGTACCAGGAGAAGGG - Intronic
1134053795 16:11156551-11156573 CTGAAACGGCAGCAGGAGGAAGG - Intronic
1135807006 16:25552058-25552080 CTGAGTAGGAGGCAGGAGGATGG - Intergenic
1137442027 16:48505962-48505984 CAGGGAAGGTAGGAGGAGGAGGG + Intergenic
1137462789 16:48680532-48680554 CAGCATTGGGAGCAGAAGGAAGG - Intergenic
1137704993 16:50528907-50528929 GAGAAGAGGTAGCAGCAGCAGGG - Intergenic
1137834027 16:51573238-51573260 CAGAGTAGGGAGCAGAAGGTGGG + Intergenic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1139935187 16:70565338-70565360 CAGAATAAGAAGCAAGAGTAAGG - Intronic
1139983923 16:70882320-70882342 CAGAATATGCAGCTGGAGGTAGG + Intronic
1140038109 16:71386430-71386452 CAGAATCGGGAGCTGGGGGAGGG + Intronic
1140357047 16:74315377-74315399 TAGAATAGGGAGGAGGGGGAAGG - Intergenic
1143303447 17:5927913-5927935 CATATCTGGTAGCAGGAGGAAGG + Intronic
1143740818 17:8952828-8952850 CAGGAAAGGTAGGGGGAGGAGGG + Intronic
1145965529 17:28914043-28914065 CAGGATAGATAGAAGGAGGAAGG + Intronic
1146522935 17:33540372-33540394 CAGCATAGGTAGTAGGAGTTAGG + Intronic
1147305934 17:39564417-39564439 CAGGATTGGTGGTAGGAGGAAGG - Intronic
1147427345 17:40352196-40352218 GGGAAGAGGCAGCAGGAGGAGGG - Intronic
1147773906 17:42887007-42887029 CAGCAGAGGCAGCAGGAAGAGGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149114033 17:53070018-53070040 CATAATAGGTAGCTGGTGGCCGG - Intergenic
1150891347 17:69153792-69153814 CACAATTTGTAGCAGGAGGAAGG - Intronic
1151398423 17:73840259-73840281 CTGAAGAGGTTGCATGAGGAAGG + Intergenic
1151535986 17:74738950-74738972 CATAGTGGGTAGAAGGAGGAGGG - Intronic
1152328044 17:79653669-79653691 AAGAATAGGCAGAAGTAGGAAGG + Intergenic
1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG + Intronic
1153641607 18:7162540-7162562 CAGCCTTGGCAGCAGGAGGAAGG - Intergenic
1154050395 18:10950715-10950737 CAGAAGAGGGAAGAGGAGGAAGG - Intronic
1154982523 18:21515120-21515142 AAGAAGAGGTAGCCGGAGGTTGG - Intronic
1155453145 18:25983875-25983897 CTGAATGGGTAGCAGGAACAAGG + Intergenic
1156197423 18:34790954-34790976 GAGAATAGGCAGCGGGAGGATGG + Intronic
1156856371 18:41786217-41786239 GAGAGGAGGCAGCAGGAGGAGGG + Intergenic
1158095319 18:53763636-53763658 CAAAAAAGGTAGAAAGAGGAAGG + Intergenic
1159517545 18:69476699-69476721 GAGAAGAGGTAGCAGGAAGCAGG + Intronic
1161627767 19:5337141-5337163 CTTAATGGGTAGCAGGGGGAAGG + Intronic
1161715492 19:5873948-5873970 CAGACCAGGTAGCAGCAGGAAGG + Intronic
1161915788 19:7226874-7226896 CAAAATTGGCAGGAGGAGGAGGG - Intronic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1163786294 19:19276685-19276707 CAAAACAGATAACAGGAGGAGGG + Intronic
1163827864 19:19533606-19533628 GAGAATGGGGAGGAGGAGGATGG - Intronic
1164486699 19:28662994-28663016 CAGTAAAAGTAGCAGTAGGAAGG - Intergenic
1165894543 19:39133733-39133755 CAGGACAGGTGGCAGGAGCAGGG - Intronic
1166436182 19:42767751-42767773 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166455925 19:42939240-42939262 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166471858 19:43084719-43084741 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166482991 19:43188535-43188557 CAGAAGAGGGAGCAGCAGGATGG + Intronic
1166485473 19:43207667-43207689 CAGAAGAGGGAGCAGCAGGGTGG + Intergenic
1166492625 19:43271573-43271595 CAGAAGAGGGAGCAGCAGGGTGG + Intergenic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1168450584 19:56463258-56463280 CAGAAGAGGGAGCAGGAGTGAGG + Intronic
925265641 2:2564599-2564621 CAGTAAAGGCAGCAAGAGGAAGG - Intergenic
930957185 2:57217159-57217181 CAGAGCAGGTGCCAGGAGGAGGG - Intergenic
931683254 2:64770048-64770070 CAGAAGAGGTGGCAGGATGGAGG - Intergenic
932102663 2:68914823-68914845 CAGATTAGAAAGCAGGAGGAGGG - Intergenic
932283890 2:70516899-70516921 CAGGATAGGGAGCAGGAACAGGG - Intronic
934067179 2:88350890-88350912 CAGAACAAGTGGCAGGAAGAAGG - Intergenic
934220174 2:90075147-90075169 CATGATAGGAAACAGGAGGAGGG - Intergenic
934729785 2:96649345-96649367 CAGAAAAGGATGCAGGAGGGTGG - Intergenic
935198580 2:100836150-100836172 CATAAACGGTAGCAGCAGGAAGG - Intronic
935673544 2:105575478-105575500 GGGAGGAGGTAGCAGGAGGAGGG + Intergenic
936461617 2:112718456-112718478 CAGAAGAGGTACCTGGAGAAGGG + Intergenic
938070108 2:128303942-128303964 CAGAACAGGAAGGTGGAGGAAGG + Intronic
939017717 2:136920911-136920933 CAGAATGGTTGCCAGGAGGAGGG + Intronic
940416286 2:153425170-153425192 AAGAAGAGGTAGGAGCAGGAAGG + Intergenic
940479281 2:154207235-154207257 TAGAACATGTAGCAGGAGGTAGG - Intronic
943183936 2:184580798-184580820 CAGAATAAAGAACAGGAGGAAGG - Intergenic
943464958 2:188217867-188217889 AAGAAAAGGGAGCAGGAGGCTGG - Intergenic
944218568 2:197279655-197279677 CAAACTAGGAAGAAGGAGGAAGG - Intronic
944315244 2:198277733-198277755 CAGGATCTGGAGCAGGAGGAGGG - Intronic
946456784 2:219832940-219832962 GAGAAAAGGAGGCAGGAGGAGGG + Intergenic
946883802 2:224202816-224202838 TACAACAGGTAGGAGGAGGAGGG + Intergenic
946961460 2:224989807-224989829 GAGTAGAGGTAGCAGTAGGAGGG - Intronic
947016505 2:225626409-225626431 CAGAACAGGACACAGGAGGATGG + Intronic
948111725 2:235461691-235461713 CAGCATAGGTGGCAGCAGGGTGG - Intergenic
1170037249 20:12002587-12002609 CAGCATAAGTAGCAGGTGTATGG + Intergenic
1170044451 20:12070903-12070925 CAGAATAGACACCAGGAAGAAGG + Intergenic
1170271407 20:14531095-14531117 CAGGGAAGGTAGGAGGAGGAGGG + Intronic
1172621610 20:36321303-36321325 GAGAATAGGGAGCAAGAAGACGG + Intronic
1173817264 20:45997804-45997826 ATGAATAGGAAGCTGGAGGAGGG + Intergenic
1175260859 20:57673229-57673251 GAGAATGGGCAGCAGGAGGAGGG - Intronic
1175446336 20:59022827-59022849 CAGAACTGAAAGCAGGAGGAAGG - Exonic
1175732067 20:61360940-61360962 ATGAAAATGTAGCAGGAGGAGGG + Intronic
1177316356 21:19466758-19466780 CTGAATAGGTAGCAGGTGTGTGG + Intergenic
1178457855 21:32772203-32772225 CAGATGAGGGAGGAGGAGGAGGG + Intergenic
1178721713 21:35016591-35016613 CAGAAGAAGGAGCAGGATGAGGG - Intronic
1179548909 21:42130912-42130934 CTGAGTAGGAAGCAGGAGAATGG - Intronic
1179725124 21:43337707-43337729 CAGTACAGGTGGCAGGAAGAGGG - Intergenic
1182373281 22:29827320-29827342 GGGAAGTGGTAGCAGGAGGATGG + Intronic
1182418978 22:30239490-30239512 CCAAATAGGCAGCGGGAGGAGGG + Intergenic
1182848080 22:33447766-33447788 CAGCACAGGGAGGAGGAGGAAGG + Intronic
1183987653 22:41578267-41578289 CAGGAGAGGTAGGGGGAGGACGG + Intronic
1185266659 22:49907531-49907553 CAGAGGAGGAGGCAGGAGGATGG + Intronic
1185412496 22:50692101-50692123 AAGAAAAGCTAGCAGAAGGAAGG - Intergenic
949961806 3:9318432-9318454 CGGGGTAGGTAGCAGGGGGAAGG - Intronic
950183985 3:10933876-10933898 CAGAATAAAGAGCAGCAGGAGGG - Intronic
953386412 3:42508733-42508755 GAGAAAAGGTGGGAGGAGGAAGG - Intronic
953845983 3:46426790-46426812 CAAAAGAGATAGCAGGAAGAGGG - Intergenic
954115389 3:48464371-48464393 CAGAATAGGGGGCTGGAGGCAGG + Intronic
955497960 3:59556134-59556156 CAGAACAGGAAGCTGGAAGAAGG - Intergenic
958055472 3:88405305-88405327 CTGAATAAGTAGCAGGGTGAAGG - Intergenic
958458309 3:94361175-94361197 CAGCCTACATAGCAGGAGGAAGG + Intergenic
959019962 3:101178075-101178097 CAGAACATGTATCAAGAGGAGGG + Intergenic
959191721 3:103121049-103121071 CAGATTCAGAAGCAGGAGGATGG + Intergenic
959633070 3:108531092-108531114 CTGAATGGGTAGCAGGATGCAGG + Intergenic
960574038 3:119211986-119212008 ATGAAGAGGTAGCAGGAGGGTGG - Exonic
963681353 3:148381822-148381844 CAGCAAAGATAGCAGGAGGCAGG + Intergenic
963796476 3:149635603-149635625 CGGAAGAGGGAGGAGGAGGAAGG + Intronic
966185639 3:177224202-177224224 CAGAATAAGTAGCATGATGAAGG - Intergenic
967098733 3:186198342-186198364 CTGAATAGGTAACAAGAGTAGGG + Intronic
969039122 4:4280935-4280957 CAGAATAGGTAGCAGGAGGAAGG - Intronic
969179154 4:5424051-5424073 CAGAGTGGGTACCAGGAGCAGGG - Intronic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969721403 4:8894554-8894576 CAGAACAGGAGACAGGAGGAGGG - Intergenic
971008196 4:22399179-22399201 AAGAAAAAGTAGCAGGAGAATGG - Intronic
972930451 4:44065673-44065695 CAGAATAAGTGGCAGAAGGAAGG - Intergenic
974103279 4:57440581-57440603 TAAAAAAGGTAGAAGGAGGAAGG - Intergenic
974962838 4:68725013-68725035 ATGGATAGGTAGCAGAAGGAGGG + Intergenic
974997144 4:69175346-69175368 CAGAATAGGAGGAAGGTGGAGGG + Intronic
975469303 4:74747002-74747024 CAGAATAGTGAGCAGAAAGAGGG + Intronic
975538056 4:75472677-75472699 CAGAATAGCTGGAAGGAGGTGGG + Intergenic
975845807 4:78524080-78524102 CAGAGTAGGAACCAGGAGGAGGG - Intronic
977551827 4:98450721-98450743 CAGAAGAGATGGCAGGAGCAGGG + Intergenic
977710239 4:100116184-100116206 CAGAAAAGTTAGCAGGAAAAAGG - Intergenic
977839521 4:101685375-101685397 AAGAATAGGTGGCAGATGGAGGG - Intronic
978124914 4:105123973-105123995 CAGAAAAGGTTGGAGAAGGAGGG - Intergenic
979086546 4:116417730-116417752 CAGAGTAGGAGGTAGGAGGAGGG + Intergenic
982062210 4:151615933-151615955 CAGAATGGGTGACAGGAGGGTGG + Intronic
982172822 4:152678427-152678449 TAGAAGAGGTGGAAGGAGGATGG + Intronic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
984179504 4:176464314-176464336 CAGATGTGGGAGCAGGAGGATGG + Intergenic
984535487 4:180969685-180969707 GAGAATAGATAGAAGGAGTAAGG + Intergenic
984847641 4:184121181-184121203 TAGAATAGGGAAAAGGAGGAGGG - Intronic
985121280 4:186645036-186645058 GAAAACAGGAAGCAGGAGGAAGG + Intronic
986037606 5:3955058-3955080 AAGAATAGGAAGAAGAAGGAAGG - Intergenic
986396093 5:7332252-7332274 CAAAATTGGCAGCAGCAGGATGG + Intergenic
986751903 5:10794907-10794929 CAGAATTCTTAGGAGGAGGAGGG + Intergenic
987261872 5:16212532-16212554 AAGAATAAGTTTCAGGAGGAAGG - Intergenic
987909821 5:24126792-24126814 CAGTTTGGGTATCAGGAGGATGG + Intronic
988885117 5:35548097-35548119 CAGAATAGAGTGCAGGAAGAAGG - Intergenic
989677927 5:43994037-43994059 TAGATTAGGTAGGAGGTGGAAGG + Intergenic
992081895 5:73241372-73241394 CTGAAAAGGTGGTAGGAGGAAGG + Intergenic
992234222 5:74692669-74692691 CAGAATAGTTAGCTGCAGGTAGG - Intronic
993100855 5:83538170-83538192 AAGAAAAGGAAGGAGGAGGAGGG + Exonic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994801680 5:104385132-104385154 AAGAATAAGTAGGAAGAGGAGGG - Intergenic
995495556 5:112738130-112738152 CAGAAGAGGAAGAAGGGGGAGGG + Intronic
995508798 5:112887201-112887223 CAGCATGGGTAACAGGAGGGTGG + Intronic
996438731 5:123465086-123465108 CAAAAAAGATAGAAGGAGGATGG + Intergenic
996784595 5:127224688-127224710 CTGAATGGGTTGGAGGAGGAAGG + Intergenic
997093682 5:130886386-130886408 CAGAAAAGGGAGGGGGAGGAGGG - Intergenic
998429950 5:142062213-142062235 CATAGTAGGTAGTAGGGGGAAGG + Intergenic
998592222 5:143489867-143489889 CAGATTCGGTAGCAGAAGAAAGG - Intergenic
1000049278 5:157547999-157548021 TAGAACAGAGAGCAGGAGGAAGG - Intronic
1002563926 5:180099691-180099713 CAGGATGGGTATCAGGAGGATGG - Intergenic
1003455288 6:6276238-6276260 GAGGATTGGAAGCAGGAGGAGGG + Intronic
1004410176 6:15374201-15374223 CAGAAGAGGCAGCATGCGGAAGG + Exonic
1005250483 6:23940573-23940595 AAGATTAGGTATCAGGATGATGG - Intergenic
1006368921 6:33632684-33632706 CAGCAGAGGGAGCAGGAGGATGG - Intronic
1006514367 6:34537899-34537921 CAGAATGGGAGGCAGGGGGATGG + Exonic
1006574131 6:35031530-35031552 CAAAATGGGGAGGAGGAGGAAGG - Intronic
1008831109 6:55763536-55763558 CAGAATAAGCCGTAGGAGGAAGG + Intronic
1011792338 6:90912131-90912153 CACAATAGGTAGCAGTTGCATGG - Intergenic
1011957325 6:93039086-93039108 CAGAAGAGGTAACAGTAGCATGG + Intergenic
1012980975 6:105830806-105830828 CAGAAGGGGCAGCTGGAGGAGGG + Intergenic
1013376361 6:109518964-109518986 CAGAACACCTAGAAGGAGGAGGG - Intronic
1013474502 6:110495030-110495052 GAGAATTGGAAGCAGCAGGATGG - Intergenic
1014089242 6:117384816-117384838 CAGATTAGAGGGCAGGAGGAAGG + Intronic
1015206909 6:130650527-130650549 CAAAATAAGTAGCAAGAGGAAGG + Intergenic
1015235093 6:130961859-130961881 CAAAAATGGTAGCAAGAGGATGG + Intronic
1016014368 6:139168571-139168593 CAGGACAGGTAGAAGCAGGAGGG - Intronic
1018038064 6:159898613-159898635 AAGAAGAGGGAGGAGGAGGAAGG - Intergenic
1020430599 7:8113020-8113042 CAGATAAGGCAGCAGCAGGAAGG - Intergenic
1021058144 7:16076334-16076356 GGGAATAGGTAGCACAAGGAAGG + Intergenic
1021284503 7:18763376-18763398 CAGTATAGGTAGCAGTAGCTTGG + Intronic
1021616151 7:22505100-22505122 GAGAAGAGGAAGAAGGAGGAAGG + Intronic
1022196322 7:28070680-28070702 TAGAGGAGGTAGCAGGAAGATGG + Intronic
1022925942 7:35056316-35056338 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1023462269 7:40411610-40411632 CAGGAAAGGTAGCAGGGAGAGGG + Intronic
1023549701 7:41356746-41356768 CAGAAAAGGGAACAGCAGGATGG - Intergenic
1023710443 7:42986896-42986918 CAGGATAGGAAGAAAGAGGAAGG + Intergenic
1023728039 7:43164227-43164249 CAGAGAAGGCAGGAGGAGGAAGG + Intronic
1025198712 7:56949441-56949463 AGGAATAGGGAGAAGGAGGAGGG - Intergenic
1025673236 7:63627490-63627512 AGGAATAGGGAGAAGGAGGAGGG + Intergenic
1026205617 7:68255040-68255062 AAGAAGAGGAAGGAGGAGGAGGG - Intergenic
1026581553 7:71622799-71622821 CACTATAGGTAGCAGGAAGTTGG + Intronic
1027624545 7:80530381-80530403 CAGAATTGATAGGAGGAGAAAGG + Intronic
1027701000 7:81470094-81470116 CAGAATAGAATCCAGGAGGAAGG + Intergenic
1027783390 7:82549002-82549024 CACCATAGGTAGCAGAAGCAAGG + Intergenic
1027900667 7:84110265-84110287 AAAACTAGGGAGCAGGAGGAAGG - Intronic
1028376320 7:90149235-90149257 GAGAAGAGGAAGAAGGAGGAAGG - Intergenic
1028399131 7:90405640-90405662 CAGATGTGGTAGCAGGAGGGAGG - Intronic
1029422082 7:100477099-100477121 CAGAAAATGAAGTAGGAGGAAGG + Intronic
1029704403 7:102268467-102268489 GAGAAGAGGCAGCAGGAGGCAGG - Intronic
1029812111 7:103059775-103059797 AAAGATAGGTAGCAGGAGAAAGG - Intronic
1029823948 7:103171006-103171028 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1031386365 7:121156679-121156701 CAGAAATGATAGAAGGAGGATGG + Intronic
1031544749 7:123037016-123037038 CAGAATAAGTGACTGGAGGAGGG - Intergenic
1031953725 7:127920394-127920416 CTGCAGAGGTCGCAGGAGGATGG + Intronic
1032066338 7:128774359-128774381 CAGCAAAGGAAGTAGGAGGAGGG - Intronic
1032498645 7:132382210-132382232 GAGAAGAGGAAGCAGGAAGAGGG + Intronic
1032650383 7:133871664-133871686 AAGAATGTGAAGCAGGAGGAAGG - Intronic
1033446104 7:141423533-141423555 TAGAATATGGAGGAGGAGGAGGG + Intronic
1033595744 7:142856598-142856620 CACTCTAGGTAGAAGGAGGATGG + Intronic
1033613175 7:142985203-142985225 TAGAATAGGTAGGAGGGAGAAGG + Intergenic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034496976 7:151428886-151428908 CAGATTAGGGAGCAGGGGGCTGG + Intronic
1034931701 7:155168337-155168359 CAGAACATGCAGCAGCAGGAGGG - Intergenic
1034935334 7:155196110-155196132 GAAAATAGGAAGCAGGAAGATGG - Intergenic
1035390034 7:158497534-158497556 CCAAATTGGTAGCAGGAGGAGGG + Intronic
1035452338 7:158985555-158985577 CAGAATAGGTCGAGAGAGGACGG + Intergenic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1037906398 8:22718301-22718323 CAGGAAAGGGATCAGGAGGATGG + Intronic
1038293966 8:26274039-26274061 AAGAAGAGGTGGCAGGAGGAAGG - Intergenic
1038675584 8:29619963-29619985 CAGCATGGGTAGCTGGTGGATGG + Intergenic
1038900842 8:31841994-31842016 TAGAATGGGGAGGAGGAGGAGGG - Intronic
1039751915 8:40486398-40486420 GAGAAGAGGAAGGAGGAGGAGGG - Intergenic
1040911066 8:52519709-52519731 CAGAGTAAGTAGCAGGAGATGGG - Intergenic
1041313469 8:56539163-56539185 CAGAATGGGGAGGAGGAGGGAGG + Intergenic
1044372327 8:91426684-91426706 CAGAAGAGGGAGGAGGAAGAGGG - Intergenic
1044950110 8:97427644-97427666 CAGGAGAGGTGGCAGTAGGAAGG + Intergenic
1046711173 8:117513203-117513225 CAGAATGGTGAGGAGGAGGAGGG - Intergenic
1047415817 8:124663661-124663683 CAGAGGAGGTGGGAGGAGGATGG - Intronic
1048170450 8:132101097-132101119 AACAATAGGTACCAGCAGGATGG + Intronic
1048435624 8:134414317-134414339 CAGGATAGGAAGCAGGAGCAAGG - Intergenic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1048798538 8:138174079-138174101 CAGAATAGATGGTATGAGGAAGG - Intronic
1049290009 8:141796825-141796847 CAGAATGGGAGGCGGGAGGAGGG + Intergenic
1049346018 8:142139086-142139108 CAGCAAAGATACCAGGAGGAGGG + Intergenic
1049558185 8:143294087-143294109 CAGGAGGGGCAGCAGGAGGAGGG - Intronic
1052997163 9:34557249-34557271 CAGAACATGCAGCAGGGGGAAGG - Intronic
1054728423 9:68676292-68676314 CAGGAGAGGAAGCAGGTGGATGG - Intergenic
1057785093 9:98081381-98081403 CAGAATATGTAACAGGAGTGAGG + Intronic
1057884779 9:98822070-98822092 CAAACTAGGCAGGAGGAGGAGGG - Intronic
1059106945 9:111520285-111520307 CAGAATAGGTACAGGGAAGAGGG - Intergenic
1059431215 9:114251436-114251458 CAGAAGGGGAAGGAGGAGGAGGG - Intronic
1060295151 9:122338296-122338318 CAGGATAGGAGGCTGGAGGATGG - Intergenic
1060680332 9:125557136-125557158 GAGAATAGGAAGGAGGGGGAAGG - Intronic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061185820 9:129052597-129052619 CAGCGGAGGTAGAAGGAGGAGGG + Intronic
1062683582 9:137798441-137798463 CAGCAAAGGAAGCAAGAGGAGGG + Intronic
1203624626 Un_KI270750v1:1967-1989 CACAATTGGTAGCAGAAGGTAGG - Intergenic
1187221327 X:17328981-17329003 GACAATAGATAGCAGCAGGAAGG - Intergenic
1187524185 X:20039074-20039096 CAGAATGGGTAGTAGAAGAAGGG + Intronic
1188461782 X:30435516-30435538 CATAAGAGGGAGCAGGAGGAGGG - Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1189966471 X:46378744-46378766 CTGAATAGGTTGCAGGGGGTTGG - Intergenic
1190942975 X:55061386-55061408 GAGAGTAGAGAGCAGGAGGAGGG - Intergenic
1191736002 X:64388403-64388425 GAAAATATGTAACAGGAGGAAGG + Intronic
1195556205 X:106227896-106227918 CAGAAGGGGTAGCAGAAGAAGGG - Intergenic
1196342911 X:114616668-114616690 TAGAATAGGTAGCATAAGTAAGG - Intronic
1197321239 X:125033558-125033580 TACAGTAAGTAGCAGGAGGAAGG + Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1199518245 X:148703699-148703721 TAGCATAGGTAGCAAGAAGAGGG - Intronic
1199716338 X:150509567-150509589 CAGAGTATGTAGAAGGAGGGAGG - Intronic
1200128357 X:153828793-153828815 CCGAAAAGGAAGCAGGAGGATGG + Intronic
1200397197 X:155998246-155998268 CAGAAGAGGAGCCAGGAGGATGG + Intronic