ID: 969039371

View in Genome Browser
Species Human (GRCh38)
Location 4:4283160-4283182
Sequence CAAGTTAACCCCTTCTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969039371_969039378 5 Left 969039371 4:4283160-4283182 CCCCCCAAGAAGGGGTTAACTTG 0: 1
1: 0
2: 0
3: 6
4: 73
Right 969039378 4:4283188-4283210 TTGCCCAGGCTGGAGTGCAGTGG 0: 66497
1: 175004
2: 225621
3: 191618
4: 110379
969039371_969039381 16 Left 969039371 4:4283160-4283182 CCCCCCAAGAAGGGGTTAACTTG 0: 1
1: 0
2: 0
3: 6
4: 73
Right 969039381 4:4283199-4283221 GGAGTGCAGTGGTGAAATCTCGG 0: 128
1: 14632
2: 66457
3: 136761
4: 148262
969039371_969039376 -9 Left 969039371 4:4283160-4283182 CCCCCCAAGAAGGGGTTAACTTG 0: 1
1: 0
2: 0
3: 6
4: 73
Right 969039376 4:4283174-4283196 GTTAACTTGCTCTGTTGCCCAGG No data
969039371_969039377 -5 Left 969039371 4:4283160-4283182 CCCCCCAAGAAGGGGTTAACTTG 0: 1
1: 0
2: 0
3: 6
4: 73
Right 969039377 4:4283178-4283200 ACTTGCTCTGTTGCCCAGGCTGG 0: 173
1: 21237
2: 68494
3: 154671
4: 197382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969039371 Original CRISPR CAAGTTAACCCCTTCTTGGG GGG (reversed) Intronic
900711006 1:4113981-4114003 AAAGTTACCCCCTACTTTGGAGG + Intergenic
900922165 1:5679906-5679928 CAAGGCAACCCCTTCTTAGAAGG + Intergenic
906509253 1:46401482-46401504 CAAGAAGACCCCATCTTGGGAGG - Intronic
906693383 1:47807935-47807957 CAAGTTCACCCCTTCTCAGTTGG - Intronic
909550350 1:76893073-76893095 TAATTTAACCCCGTCTTGGCAGG + Intronic
912390362 1:109298358-109298380 CAAATTAAGCCCTTCTTAGAGGG + Intronic
912746442 1:112249219-112249241 CCAGTTAGCCCCTTGTTGAGAGG - Intergenic
913564022 1:120053182-120053204 GAAGTTAATGCATTCTTGGGTGG - Intronic
913634103 1:120740383-120740405 GAAGTTAATGCATTCTTGGGTGG + Intergenic
914284611 1:146212530-146212552 GAAGTTAATGCATTCTTGGGTGG - Intronic
914545642 1:148663269-148663291 GAAGTTAATGCATTCTTGGGTGG - Intronic
914620921 1:149407397-149407419 GAAGTTAATGCATTCTTGGGTGG + Intergenic
918760749 1:188402954-188402976 CAAGTTAACCTCTTAATGGGTGG + Intergenic
920073489 1:203320451-203320473 CCAGTGAACACGTTCTTGGGTGG + Intergenic
1068614840 10:59102314-59102336 CAAGTTACCCCATTCTCTGGTGG + Intergenic
1068865755 10:61894372-61894394 AAAGTAAACCCCCTCGTGGGTGG - Intergenic
1072434862 10:95405693-95405715 CAAGTTCTCTCCTTTTTGGGTGG - Intronic
1076492954 10:130875989-130876011 CAAGAGAACCACTTCCTGGGAGG - Intergenic
1077526330 11:3067893-3067915 GAAGAAAACCCCTTCTGGGGAGG + Intergenic
1083297913 11:61725154-61725176 CAAGCTAGCCCCTTCTTGCTCGG + Intronic
1086270337 11:85055799-85055821 CAAGTTAATTCCTTATTGGTGGG - Intronic
1090998815 11:131891141-131891163 CAAGCTAATCCCTTGTAGGGAGG + Intronic
1096723726 12:53544448-53544470 TAAGATCACCCCTTCTTGGCTGG + Intronic
1097990388 12:65826055-65826077 CGAGTTAACCCCGTCCTGCGGGG - Intronic
1102970150 12:117160016-117160038 CAAGATCACCACTTCTGGGGTGG + Intronic
1104620925 12:130312338-130312360 CAAGTTTCCCCCTTCTTAGAAGG + Intergenic
1105976372 13:25477142-25477164 CAAGTTGACCCCTGTGTGGGTGG + Intronic
1110319649 13:74147255-74147277 CAAGTGCACCCCTTCCTGGTTGG + Intergenic
1110601940 13:77385266-77385288 CAAGTTCTCCCCATCTTGTGTGG - Intergenic
1110724980 13:78811908-78811930 CAAGTGAATGCCTTCTTGGCTGG + Intergenic
1117420276 14:55537957-55537979 GAAGTTAACCCTTTCTTTGGTGG + Intergenic
1128351967 15:66896922-66896944 AAAGTTGTTCCCTTCTTGGGTGG - Intergenic
1130871425 15:87975149-87975171 ACAGTAAACCCATTCTTGGGAGG + Intronic
1134212381 16:12288585-12288607 CAGGCTAAGCCCTTCTTTGGGGG + Intronic
1138506300 16:57479937-57479959 GCAGTTAACCCCTTCCTGGGAGG + Intronic
1142762784 17:2051394-2051416 AAAGTTAACCCCTTGTCGGCTGG - Intergenic
1146799970 17:35810345-35810367 CAAGTTAACTGCTTCGTGGGGGG - Intronic
1149363366 17:55916393-55916415 CAAGATCTCCCCTTCTTGGTAGG + Intergenic
1152685739 17:81693147-81693169 CCTGTTTGCCCCTTCTTGGGTGG + Intronic
1156214393 18:34981068-34981090 AATGTTAACACCTTTTTGGGAGG + Intronic
1159888907 18:73936376-73936398 CAAGTTTCCACGTTCTTGGGAGG + Intergenic
1163145135 19:15374584-15374606 CAAGGTAAGCCCTTCTGTGGGGG - Exonic
1165571040 19:36775261-36775283 CAAGTTAACTGCTTCGTGGGGGG + Intronic
925846948 2:8043173-8043195 CAAGTTAATGCCTTCTTGCAGGG + Intergenic
928304525 2:30156563-30156585 CATGTTAGCACCTACTTGGGGGG - Intronic
929472383 2:42208056-42208078 CAATTTCACCTCTTCTTTGGTGG + Intronic
932490863 2:72119399-72119421 TGCGTTAACCCCTTCTTGGAGGG - Intergenic
943512141 2:188839471-188839493 CAACTTAACCCATTCATGAGGGG + Intergenic
946869340 2:224071836-224071858 CAGGTTTTCCCCATCTTGGGAGG - Intergenic
1169354906 20:4898088-4898110 CAGGTTGAGCCCTTCTTGGAAGG + Intronic
1182079423 22:27518572-27518594 CCAGTTAACTCCTTCTTGCCTGG - Intergenic
1185149190 22:49154392-49154414 CAGGACACCCCCTTCTTGGGTGG + Intergenic
949962991 3:9329763-9329785 CAAGTTTCCCCTTTTTTGGGTGG + Intronic
953383285 3:42490192-42490214 TTATTTAACCCCTTCTTTGGGGG - Intronic
956295850 3:67713189-67713211 CAAGTTAAACAATTCTGGGGAGG - Intergenic
960079933 3:113530902-113530924 CAAGTCAACACCTTCTTTTGGGG - Intergenic
960823642 3:121759965-121759987 CAAGTTGAGGCCTACTTGGGAGG + Intergenic
963007137 3:140737027-140737049 CAAGTTGGGCCCTTCTTGGCTGG + Intergenic
969039371 4:4283160-4283182 CAAGTTAACCCCTTCTTGGGGGG - Intronic
976186587 4:82448562-82448584 AAACTTAAGCCCTTTTTGGGTGG - Intronic
978600737 4:110424908-110424930 GAAATTAACCCATTTTTGGGTGG - Intronic
984995343 4:185425561-185425583 CAGGTTAAGCCCTTCTTGCAAGG + Intronic
994034329 5:95181066-95181088 CAAGAAAACCCCTTCCTGGCTGG - Intronic
995921737 5:117322411-117322433 TAAGGTAACCCATACTTGGGTGG - Intergenic
1006338181 6:33431784-33431806 CCAGCTAGCCCCTTCTGGGGTGG + Intronic
1011183860 6:84652332-84652354 CTAGTTCACCTCATCTTGGGTGG + Intergenic
1013324333 6:109029655-109029677 CCTGTTAAACCCTACTTGGGAGG - Intronic
1017218556 6:151938699-151938721 TAAGTTAACACCTCCTAGGGTGG + Intronic
1023002448 7:35824261-35824283 ATAGTTAACCACTTCTTGAGGGG + Intronic
1023832054 7:44045025-44045047 CAGGTTAAACCCGGCTTGGGGGG + Intronic
1033536378 7:142315919-142315941 CAAGTTATCCACTTTTTGAGTGG + Intergenic
1038110042 8:24486317-24486339 CAAGTTAACCAATTCTTGCATGG + Intronic
1038346540 8:26737369-26737391 CAAATTAACCCTTTATTGTGTGG + Intergenic
1047514395 8:125541134-125541156 CCAGCTGACCACTTCTTGGGAGG - Intergenic
1050667613 9:7958870-7958892 CAACTCACCCCCTTCTTGTGGGG - Intergenic
1054724384 9:68635545-68635567 CAAGTTAAGAACTTGTTGGGTGG - Intergenic
1057302082 9:93892442-93892464 CAACTTGACCTCTTCTTGGGAGG + Intergenic
1061593542 9:131614144-131614166 CAAGGCAGCCCCTCCTTGGGGGG - Intronic
1189177631 X:38973806-38973828 CAAGTAAACCCTTTATTTGGAGG + Intergenic
1201356191 Y:13099224-13099246 CGAGATAACCCCTTCTGGGCTGG - Intergenic