ID: 969042345

View in Genome Browser
Species Human (GRCh38)
Location 4:4308983-4309005
Sequence ATTGTCTGCATAGGGATGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969042341_969042345 8 Left 969042341 4:4308952-4308974 CCCTGGCATGCTGGGGCAAGAAA 0: 1
1: 0
2: 3
3: 28
4: 336
Right 969042345 4:4308983-4309005 ATTGTCTGCATAGGGATGCGTGG 0: 1
1: 0
2: 0
3: 3
4: 60
969042342_969042345 7 Left 969042342 4:4308953-4308975 CCTGGCATGCTGGGGCAAGAAAG 0: 1
1: 0
2: 2
3: 43
4: 268
Right 969042345 4:4308983-4309005 ATTGTCTGCATAGGGATGCGTGG 0: 1
1: 0
2: 0
3: 3
4: 60
969042338_969042345 16 Left 969042338 4:4308944-4308966 CCTGGCATCCCTGGCATGCTGGG 0: 1
1: 0
2: 2
3: 35
4: 321
Right 969042345 4:4308983-4309005 ATTGTCTGCATAGGGATGCGTGG 0: 1
1: 0
2: 0
3: 3
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969042345 Original CRISPR ATTGTCTGCATAGGGATGCG TGG Intronic