ID: 969043134

View in Genome Browser
Species Human (GRCh38)
Location 4:4316749-4316771
Sequence GCATATAACCAGAGGAAACT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969043132_969043134 -9 Left 969043132 4:4316735-4316757 CCAGCAGGACTTCTGCATATAAC 0: 1
1: 1
2: 0
3: 14
4: 125
Right 969043134 4:4316749-4316771 GCATATAACCAGAGGAAACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969043134 Original CRISPR GCATATAACCAGAGGAAACT CGG Intronic
No off target data available for this crispr