ID: 969043134 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:4316749-4316771 |
| Sequence | GCATATAACCAGAGGAAACT CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 969043132_969043134 | -9 | Left | 969043132 | 4:4316735-4316757 | CCAGCAGGACTTCTGCATATAAC | 0: 1 1: 1 2: 0 3: 14 4: 125 |
||
| Right | 969043134 | 4:4316749-4316771 | GCATATAACCAGAGGAAACTCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 969043134 | Original CRISPR | GCATATAACCAGAGGAAACT CGG | Intronic | ||
| No off target data available for this crispr | |||||