ID: 969047507

View in Genome Browser
Species Human (GRCh38)
Location 4:4347207-4347229
Sequence GCAATTGGACAGTGTTTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969047502_969047507 6 Left 969047502 4:4347178-4347200 CCTACATTGCTGTGGCCTCTTTT No data
Right 969047507 4:4347207-4347229 GCAATTGGACAGTGTTTCCCAGG No data
969047506_969047507 -9 Left 969047506 4:4347193-4347215 CCTCTTTTCGGGAAGCAATTGGA No data
Right 969047507 4:4347207-4347229 GCAATTGGACAGTGTTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969047507 Original CRISPR GCAATTGGACAGTGTTTCCC AGG Intergenic
No off target data available for this crispr