ID: 969050403

View in Genome Browser
Species Human (GRCh38)
Location 4:4369002-4369024
Sequence GTCCCACTCCACCATGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969050403_969050408 -9 Left 969050403 4:4369002-4369024 CCAGCCCCATGGTGGAGTGGGAC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 969050408 4:4369016-4369038 GAGTGGGACGTAGCCCAGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 119
969050403_969050407 -10 Left 969050403 4:4369002-4369024 CCAGCCCCATGGTGGAGTGGGAC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 969050407 4:4369015-4369037 GGAGTGGGACGTAGCCCAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 101
969050403_969050409 -2 Left 969050403 4:4369002-4369024 CCAGCCCCATGGTGGAGTGGGAC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 969050409 4:4369023-4369045 ACGTAGCCCAGCAGGGCTGCAGG 0: 1
1: 0
2: 0
3: 11
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969050403 Original CRISPR GTCCCACTCCACCATGGGGC TGG (reversed) Intronic
900540850 1:3201982-3202004 GTCCCACACGTCCATGAGGCAGG + Intronic
900860636 1:5226719-5226741 GTCCCACTGCACAGTGGGCCTGG + Intergenic
901783361 1:11608938-11608960 GTGCCAGCCCACCGTGGGGCAGG + Intergenic
902926008 1:19696012-19696034 GTCGCATTCATCCATGGGGCGGG - Intronic
903335489 1:22621731-22621753 GCCCCACAGCCCCATGGGGCAGG + Intergenic
908262141 1:62347479-62347501 GACCCAGACCTCCATGGGGCTGG + Intergenic
909403249 1:75258070-75258092 GGCCCACTCCACCAGGGCCCTGG + Intronic
910136705 1:83980407-83980429 GGCGCACACCACCATGGGCCTGG + Intronic
915167446 1:153956277-153956299 AGCCCACTCCAGCATGGGCCAGG + Intronic
920261929 1:204694104-204694126 ATCCCACTCCTCCATGGCGGAGG - Intergenic
922681326 1:227599293-227599315 GTCCCACTTCCCCATGGTGCTGG + Intronic
922750389 1:228067499-228067521 GTGCCACTCCTCAATGGAGCAGG + Intergenic
923372356 1:233327376-233327398 GTCCCCCACCACCTTGGGCCGGG - Intergenic
1062978037 10:1699926-1699948 ATCCCACTCCACCAGGAGACCGG + Intronic
1062978054 10:1700010-1700032 ATCCCACTCCACCAGGAGACCGG + Intronic
1062978138 10:1700430-1700452 ATCCCACTCCACCAGGAGACCGG + Intronic
1062978198 10:1700724-1700746 ATCCCACTCCACCAGGAGACCGG + Intronic
1062978315 10:1701312-1701334 ATCCCACTCCACCAGGAGACCGG + Intronic
1063511002 10:6645609-6645631 ACACCACTCCACCATGGTGCTGG + Intergenic
1064103051 10:12479585-12479607 CTCCCACTCAGCCAAGGGGCAGG + Intronic
1067081983 10:43217210-43217232 GCACCACCCCAGCATGGGGCTGG + Intronic
1068578854 10:58715546-58715568 GTCCCGCTTCCCCATGGTGCTGG - Intronic
1071522410 10:86339465-86339487 TTCCCACTGCACCCTGTGGCTGG + Intronic
1071601726 10:86961805-86961827 GCCCCACTCCGCCAAGGGGCAGG + Intronic
1073761157 10:106630013-106630035 GTCTCACTCCATCATCAGGCTGG - Intronic
1074416910 10:113274508-113274530 ATTCCACTCCATCAGGGGGCAGG - Intergenic
1075566107 10:123505414-123505436 GTCCCACTCCTACATGGGATTGG + Intergenic
1075816229 10:125266700-125266722 GTCAGACTCCACCCTGAGGCGGG - Intergenic
1076713083 10:132349787-132349809 GGCCCACCCAACCATGGGGCAGG - Intronic
1076820978 10:132939447-132939469 GGGCCACTCCACAGTGGGGCAGG + Intronic
1077038048 11:504612-504634 TTCCCACTCCCCCCTGGGTCGGG + Intronic
1077360118 11:2137130-2137152 ATCCCACTCCAGCCTGAGGCAGG - Intronic
1077546092 11:3170691-3170713 CTCCAGCACCACCATGGGGCAGG - Intergenic
1077825466 11:5804276-5804298 GTGTCACTCCCCCATGGGCCGGG + Intronic
1079369457 11:19838267-19838289 GACCCACTCCATCGTGGGTCAGG + Intronic
1080019583 11:27546029-27546051 GGCACACTACACCAGGGGGCTGG + Intergenic
1083777430 11:64901033-64901055 GTCCCTCACAACGATGGGGCCGG + Exonic
1084036743 11:66515912-66515934 GTCCAACTCCATCAAGCGGCAGG + Exonic
1084195650 11:67522639-67522661 GTCCCCCTGCTCCTTGGGGCTGG + Exonic
1085467804 11:76736064-76736086 GTCTCACTCCACCACGTAGCTGG - Intergenic
1085564682 11:77502727-77502749 GTCCCACTCCACCAAGCAGTGGG + Intergenic
1085638887 11:78178900-78178922 CTCCCACTCCACCATGTCTCAGG + Intronic
1086983440 11:93223638-93223660 GTGCCACTCCTCCAGGGTGCTGG - Intergenic
1089323431 11:117641719-117641741 GTTCCTCTGCATCATGGGGCAGG - Intronic
1089556755 11:119319439-119319461 GCCCAGGTCCACCATGGGGCTGG - Intronic
1090007726 11:123017631-123017653 CTCCTTCTCCACCATGGTGCCGG - Intergenic
1091626523 12:2125007-2125029 CTCCCACTCCACCCTGATGCAGG - Intronic
1094820757 12:34222400-34222422 GTCTCACTCCATCACCGGGCTGG + Intergenic
1097203470 12:57299878-57299900 GTCCCCCTCCTCCCTGGTGCAGG + Intronic
1100449309 12:94690128-94690150 TTCCCACTCCACAATGGAGCCGG + Intergenic
1102069173 12:110003308-110003330 TTCTCACTCCAGCCTGGGGCAGG + Intronic
1102444324 12:112990035-112990057 GTCTCACTCCACCCTGCAGCTGG + Intronic
1104004709 12:124883856-124883878 CTCTCTCTCCCCCATGGGGCAGG - Intergenic
1106836808 13:33643677-33643699 GTGCCAGTCTGCCATGGGGCAGG + Intergenic
1108689875 13:52850684-52850706 CTCCCACCCCAACCTGGGGCTGG + Intergenic
1113699691 13:112375445-112375467 AGCCCTCTCCACCATGGAGCTGG + Intergenic
1115173351 14:30533423-30533445 CTCTCTCTTCACCATGGGGCAGG - Intergenic
1119783577 14:77295948-77295970 GTCCCACCTCTCCATGGTGCTGG - Intronic
1120023133 14:79552717-79552739 GTTCCTCTGCACTATGGGGCAGG + Intronic
1120476280 14:84991947-84991969 CTTCCACTCCACCGTGGGGGCGG - Intergenic
1121451493 14:94011128-94011150 TTCCCTCTGCACGATGGGGCTGG + Intergenic
1122165849 14:99823128-99823150 GTCCCACCCCACCCTGGAACCGG - Intronic
1122344180 14:101048039-101048061 GTCACACTCCATGGTGGGGCAGG - Intergenic
1122873014 14:104650217-104650239 GCCGCTCTCCACCCTGGGGCTGG - Intergenic
1122901961 14:104785735-104785757 CTTCCGCTCCACCATGGAGCAGG + Intronic
1125751739 15:42033791-42033813 GGCCCACTCCACCCAGGGCCAGG - Intronic
1127394701 15:58535220-58535242 CCCCCACCCCACCATGGGGCTGG + Intronic
1128160993 15:65422848-65422870 GTCCCCCCGCGCCATGGGGCTGG + Exonic
1132658757 16:1052455-1052477 TGGCCCCTCCACCATGGGGCGGG + Intergenic
1133325548 16:4940144-4940166 GTCTCACTCTACCACCGGGCTGG + Intronic
1135077571 16:19407363-19407385 TCCCCACTCCCTCATGGGGCTGG - Intergenic
1139650381 16:68359309-68359331 GGCCCACCCCTCCAAGGGGCTGG - Exonic
1140037652 16:71383461-71383483 GTCCCTCTCCCCCAGGGTGCAGG + Intronic
1141133666 16:81451841-81451863 CTCTTCCTCCACCATGGGGCTGG - Intronic
1141174968 16:81712837-81712859 CTGCCTCTCCACCATGGGCCCGG + Intergenic
1141980709 16:87548234-87548256 GCCACACTCCAGCATGGGGGTGG + Intergenic
1142234095 16:88913264-88913286 GTCCAGCTCCACCAAGTGGCCGG - Intronic
1144546816 17:16204837-16204859 GTCCCACAGCAGCATGGTGCTGG + Intronic
1144734365 17:17546673-17546695 CTCCCTGTCCACCCTGGGGCTGG + Intronic
1144806596 17:17972115-17972137 GTGCCACTCCACGAGCGGGCTGG - Intronic
1146633079 17:34484590-34484612 GCCCCACTGCAGCACGGGGCTGG - Intergenic
1147429697 17:40363801-40363823 CGCCCACTCCCCCATGGCGCTGG + Exonic
1147606266 17:41775508-41775530 GTCCCTCTCCACCCTGGACCTGG + Intronic
1147631924 17:41937838-41937860 GTCCCACATCAACATGGGGATGG + Intronic
1152284484 17:79404278-79404300 GTCCCAGCCCACCAGGGGCCTGG + Intronic
1152574495 17:81134105-81134127 CTCCCACTCCAGCCTGGGGTTGG - Intronic
1153637656 18:7127144-7127166 CTCCAACTCCACCATGGTGCAGG + Intergenic
1157298874 18:46465438-46465460 GTCCCTGTCCAGCAGGGGGCTGG + Intergenic
1157609770 18:48949183-48949205 GTTCCTCTGCACCCTGGGGCTGG + Intronic
1159008688 18:63038254-63038276 GTCCCACTCCAGCCTGGGCTGGG + Intergenic
1161683759 19:5693239-5693261 GGCCCACACCACCACGGGACAGG - Intronic
1162931585 19:13960304-13960326 GTCCCATGCCACCTTGAGGCTGG - Exonic
1163667358 19:18609673-18609695 GTCACACTCCAGGGTGGGGCTGG - Intronic
1163862290 19:19748668-19748690 GTCCCAGTCCACCCTGTGGGAGG + Intergenic
1164856861 19:31531508-31531530 GTCCCACTCTGCCCTGGGGGTGG + Intergenic
1165077762 19:33290322-33290344 GTCCCACACCCCCAGTGGGCGGG + Intergenic
1165090797 19:33387556-33387578 GGCCCACCCCACCATGGGATGGG + Intronic
1166231794 19:41428835-41428857 AGCCCACTCCACTCTGGGGCTGG + Intronic
1166686588 19:44800264-44800286 GTCCCAGACCACCTGGGGGCTGG - Intronic
1166894378 19:46014980-46015002 TTCCCACTACTCCATGGGGGTGG - Intronic
1167058846 19:47130923-47130945 CTCCTTCTCCACCATGGCGCCGG - Exonic
926209157 2:10856204-10856226 CCCCACCTCCACCATGGGGCAGG - Intergenic
926400341 2:12490150-12490172 TTCCCACTGCACAATGAGGCAGG + Intergenic
928052684 2:28016468-28016490 GTCCCACTTGCCCATGGTGCTGG + Intronic
933722822 2:85409292-85409314 GTCCCAGACTGCCATGGGGCTGG + Intronic
933750301 2:85598906-85598928 GGCCCACTCCTCCATGGCACAGG + Exonic
936089309 2:109490718-109490740 GGCCCACTGCACCTTGGAGCAGG - Exonic
937412591 2:121689496-121689518 TTCCAGCTCCACCAGGGGGCAGG - Intergenic
938108590 2:128549773-128549795 CACCCACCCCACCCTGGGGCTGG + Intergenic
938746314 2:134281706-134281728 TTCCCACTCCAAAATGGGGAGGG + Intronic
940730208 2:157380400-157380422 GTCCCGCTTCCCCATGGTGCTGG + Intergenic
941233337 2:162939055-162939077 TTCCGACTCTACCATGGGGTTGG - Intergenic
946390833 2:219416187-219416209 TTCCTACTCCCCCAGGGGGCAGG + Intergenic
1173904112 20:46613516-46613538 GTTCCACTCCTCAATGGCGCTGG + Exonic
1173945865 20:46950521-46950543 GTGCTCCTCCACCAAGGGGCAGG + Intronic
1175951087 20:62583720-62583742 GTGACGCTCCACCATGGGGGTGG - Intergenic
1176871618 21:14087160-14087182 GTCTCACTCCATCACCGGGCTGG + Intergenic
1178526135 21:33330994-33331016 GTGCCACTCCACCTTGGAACTGG + Intronic
1179882057 21:44297019-44297041 GTCCCAGCTGACCATGGGGCAGG + Intronic
1181342822 22:22196286-22196308 GTCTCACTTCCCCATGGGTCTGG - Intergenic
1184583824 22:45434511-45434533 GTCCCACACCAGCCTGGGGGTGG - Intergenic
950273985 3:11642919-11642941 GTCCCTCTCCCGCGTGGGGCCGG - Intronic
954304295 3:49717370-49717392 GTCCCATTTCACCAGAGGGCGGG + Exonic
954710880 3:52504556-52504578 GGCCAGCTCCACCATGGGGAGGG - Intronic
961005770 3:123404461-123404483 CTCCCACTCCACCATGGTCAGGG + Intronic
962411202 3:135143215-135143237 GGCCCACAACTCCATGGGGCTGG + Intronic
963105685 3:141645227-141645249 GGGCCACTCCTCCCTGGGGCCGG - Intergenic
968626706 4:1629175-1629197 GGCTCCCTCCACCATGGGTCTGG - Intronic
969050403 4:4369002-4369024 GTCCCACTCCACCATGGGGCTGG - Intronic
970425042 4:15938185-15938207 TTCTCACTCCACCAAGGGCCTGG - Intronic
971393073 4:26203972-26203994 GTCTCACTCTCCCACGGGGCTGG + Intronic
976146844 4:82050541-82050563 GTCTCAGTCCAGCATGGTGCTGG - Intergenic
976609118 4:87011136-87011158 GCCCTTCTCCACCCTGGGGCAGG + Intronic
984835598 4:184017161-184017183 GACCAGCTCCACCATGGGCCGGG - Exonic
990959152 5:61375104-61375126 GTCCCGCTTCCCCATGGTGCTGG - Intronic
997700796 5:135897707-135897729 GTTCCACTGCACTATGGGGAAGG + Intergenic
997818357 5:137039602-137039624 GTCCCACGCCCCCATGGGCAGGG + Intronic
998737136 5:145155085-145155107 GTGCCCATCCACCATGTGGCTGG - Intergenic
999392160 5:151201275-151201297 GTCCCACCCAACCATGAGGTGGG + Intronic
1000040170 5:157479464-157479486 CTCCCACTCCACAAAGGTGCTGG - Exonic
1002344034 5:178535791-178535813 AGCCCTCTCCACGATGGGGCTGG - Intronic
1002536864 5:179880518-179880540 GTCCCACTCCACCCAGGGCTGGG + Intronic
1006358662 6:33575428-33575450 CTCCTACAGCACCATGGGGCAGG - Exonic
1008538358 6:52525276-52525298 GCCCCACTCCCCCAGGTGGCAGG + Intronic
1010609091 6:77930526-77930548 GTCCCCTTCCACCATGGCTCAGG + Intergenic
1011211736 6:84963032-84963054 GTGCCACTCCCCCATGGGCTGGG + Intergenic
1013824064 6:114190180-114190202 CTCCCACTCCTCCATGTAGCTGG - Intronic
1016618583 6:146080917-146080939 TTCCCACTCCACCGTGGGTGTGG - Intronic
1016667175 6:146655431-146655453 ATCCCAACCCAACATGGGGCAGG - Intronic
1019594690 7:1853033-1853055 CTCCCACTCCACACTGGGACAGG - Intronic
1019602756 7:1893520-1893542 CACCCACTCCACCTGGGGGCTGG - Intronic
1023771221 7:43558400-43558422 CTCCAACTCCACCCTGGGTCTGG - Intronic
1023866231 7:44239598-44239620 CTCCGGCACCACCATGGGGCTGG - Exonic
1026513753 7:71049363-71049385 GTCCCAATCTACCATCAGGCTGG + Intergenic
1027663373 7:81014797-81014819 GTCCCACTACAGCATGGGTTAGG + Intergenic
1028599910 7:92590277-92590299 GTCCCGCTTCCCCATGGTGCTGG + Exonic
1031080517 7:117252949-117252971 GTCTCACTCTGTCATGGGGCTGG + Intergenic
1031910182 7:127508195-127508217 GTCACACTCAATCATTGGGCAGG + Intergenic
1032144701 7:129368487-129368509 GTCCCACTTCTCCATAGTGCAGG - Intronic
1034501485 7:151453534-151453556 GTCCCACACCAGCCAGGGGCGGG + Intergenic
1034829291 7:154295232-154295254 GTCTCACTCCAGCTTTGGGCTGG - Intronic
1034829601 7:154298045-154298067 GTCCCCCTCTACCATGTGGGTGG + Intronic
1035036356 7:155897790-155897812 GTCCCAGTCCATGGTGGGGCAGG - Intergenic
1037824242 8:22151529-22151551 GTCCCACTTCAGGATGGTGCAGG + Exonic
1042847888 8:73186520-73186542 GTCTCGCTCCACCCTGGGGCTGG + Intergenic
1042847984 8:73187325-73187347 GCCTCACTCCACCCTGGGGCTGG - Intergenic
1048307668 8:133295456-133295478 GTGCCACCCCAGCCTGGGGCTGG + Intronic
1049816598 8:144605959-144605981 GCCCCACTCCACGATGGGCCGGG + Intergenic
1053528487 9:38853873-38853895 GCACCATTCCACCATGTGGCAGG - Intergenic
1054200714 9:62078306-62078328 GCACCATTCCACCATGTGGCAGG - Intergenic
1054637645 9:67510057-67510079 GCACCATTCCACCATGTGGCAGG + Intergenic
1056169807 9:83973732-83973754 TTCCCACTGCAGCATGGAGCAGG + Intronic
1057009649 9:91589990-91590012 GTCCCTCTTCACCAAGAGGCTGG - Intronic
1057405390 9:94765675-94765697 TTCCCACTTTACCATGTGGCAGG + Intronic
1060816789 9:126639280-126639302 GTCCCTCTGCATCCTGGGGCCGG + Intronic
1061615585 9:131776611-131776633 CTCACAATCCACCATTGGGCAGG + Intergenic
1062031303 9:134363270-134363292 CTCCCAGTCCAGCATGTGGCAGG + Intronic
1062393862 9:136344847-136344869 GACCCCCTCCCCAATGGGGCGGG + Intronic
1186192813 X:7082756-7082778 ACCCCACCCCACCATGGGGAAGG + Intronic
1186215731 X:7298595-7298617 GTGCCACTCCACAATGGTTCAGG + Intronic
1186589097 X:10909858-10909880 CTCTCTCTCCACCCTGGGGCTGG + Intergenic
1188030215 X:25255391-25255413 GTCCCTCTCCACCATGGCTCAGG + Intergenic
1189727096 X:43978132-43978154 CCCTCACTCCACCATGGGGCAGG - Intergenic
1199847626 X:151702462-151702484 GGACCACTCCACCCTGTGGCTGG + Exonic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic