ID: 969050661

View in Genome Browser
Species Human (GRCh38)
Location 4:4370661-4370683
Sequence AGGTTGTTACAGCGGCAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969050657_969050661 -7 Left 969050657 4:4370645-4370667 CCTCTCCATTTGTGGTAGGTTGT 0: 1
1: 0
2: 12
3: 104
4: 700
Right 969050661 4:4370661-4370683 AGGTTGTTACAGCGGCAACAGGG 0: 1
1: 0
2: 1
3: 9
4: 100
969050654_969050661 9 Left 969050654 4:4370629-4370651 CCTGTTCTGGGGTCAGCCTCTCC 0: 1
1: 0
2: 4
3: 25
4: 284
Right 969050661 4:4370661-4370683 AGGTTGTTACAGCGGCAACAGGG 0: 1
1: 0
2: 1
3: 9
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969050661 Original CRISPR AGGTTGTTACAGCGGCAACA GGG Intronic
900892723 1:5461164-5461186 AACTTGTTACAGCAGCAACAGGG + Intergenic
901108534 1:6776729-6776751 AATTTGTTACAGCAGCCACAAGG + Intergenic
903209402 1:21808305-21808327 AGGGTGTTACAGGGGTTACAGGG + Intergenic
908419470 1:63945861-63945883 AGGTTGCTCTAGCTGCAACATGG + Intronic
909350216 1:74643851-74643873 ATGTTGTGACAGGGACAACAAGG - Intronic
910902625 1:92138080-92138102 AGGTTGTTTCAGCAGCTACTAGG + Intronic
1063131329 10:3180212-3180234 AACTTGTTACAGCCGCAATAAGG - Intergenic
1064325724 10:14349454-14349476 TGGTTGTTGCAGCAGCAAAAGGG - Intronic
1066463258 10:35631039-35631061 AGGTTGTTAAACCCACAACAGGG - Intergenic
1068519186 10:58060599-58060621 AAGATGTTACAGTGGCAGCAGGG + Intergenic
1070525993 10:77296462-77296484 AATTTGTTACAGCAGCAACAGGG + Intronic
1076118070 10:127914492-127914514 AGGTTGTTACTGAGGTAACATGG + Intronic
1079340612 11:19608730-19608752 AATTTGTTACAGTAGCAACAGGG - Intronic
1082686081 11:56241379-56241401 AGGTGTTTACAGTGGCAACGGGG - Intergenic
1083149313 11:60781966-60781988 AATTTGTTACAGCAGCAATAGGG - Intergenic
1084489744 11:69471791-69471813 AGAGGGTTACAGGGGCAACAGGG + Intergenic
1084724133 11:70929365-70929387 CATTTGTTACAGCAGCAACAGGG - Intronic
1084906007 11:72348130-72348152 AACTTGTTACAGCAGCAATAGGG + Intronic
1085427282 11:76415818-76415840 TGGCTGGTACAGTGGCAACAGGG - Intergenic
1085503935 11:77045178-77045200 AATTTGTTACAGCAGCAATAGGG - Intergenic
1087518768 11:99201945-99201967 AAATTTTTACAGCAGCAACAGGG + Intronic
1087909564 11:103737547-103737569 AGGTTCTTACAGAGATAACATGG + Intergenic
1087947620 11:104183195-104183217 TGGGTGTTACAGGGGCAAGATGG + Intergenic
1089566877 11:119376345-119376367 AGGCTGTTCCTGTGGCAACAGGG - Intronic
1096591520 12:52663067-52663089 GGGTGGTTACAGGGGCAAGATGG + Intergenic
1096881654 12:54678070-54678092 AGGTTCTCAGAGCAGCAACACGG - Intergenic
1097533559 12:60836943-60836965 AGGTTGTTTCAACAGCTACAAGG - Intergenic
1098661125 12:73095008-73095030 ATGATGTTACAGTGGCTACAGGG - Intergenic
1100660042 12:96686863-96686885 AATTTGTTACAGCAGCAAAAAGG - Intronic
1101195298 12:102376025-102376047 TGGTTGTTACACCTGCAACTGGG - Intergenic
1101876650 12:108600463-108600485 CATTTGTTACAGCAGCAACAGGG - Intergenic
1102809684 12:115813562-115813584 AGATTGCTACAGCAGCAACATGG - Intergenic
1107162569 13:37248806-37248828 AGGTTGTTTCAGCAGCTACTAGG - Intergenic
1110859855 13:80336819-80336841 GAGTTTTTACAGCGGCAACCAGG + Exonic
1116248578 14:42453014-42453036 AATTTGTCACAGTGGCAACAGGG - Intergenic
1118314986 14:64720674-64720696 AATTTGTTACAGTGGCAATAGGG - Intronic
1122819425 14:104334001-104334023 GGTTTGGTACAGCTGCAACAAGG - Intergenic
1125072424 15:35571568-35571590 AATTTGTTACAGCAGCAACAGGG + Intergenic
1126739133 15:51760165-51760187 AATTTGTTACAGCAGCAATAGGG - Intronic
1126771317 15:52059233-52059255 ATGTTGTGACAGTGGCTACAGGG - Intronic
1136053984 16:27674224-27674246 AAGTTGTTACAGCAGCAAATAGG - Intronic
1141821208 16:86447286-86447308 GGGTTTTTACAGAGGCAACAAGG - Intergenic
1142598615 17:1041797-1041819 AGGTTGTTCCCGCGGCCTCAGGG + Intronic
1143983625 17:10892352-10892374 AGGGTGTTACATCAGCAAAAAGG - Intergenic
1144067097 17:11634396-11634418 ATGATCTTACAGCAGCAACAGGG - Intronic
1154335236 18:13459715-13459737 AGCTTGTTATAGCAGCAATAGGG + Intronic
1155775891 18:29760559-29760581 AGGTTGATCCAGCTGCAGCATGG - Intergenic
1159428445 18:68320114-68320136 AGTTTGTTGCAGCAGCAATAAGG - Intergenic
1159701081 18:71628674-71628696 AATTTGCTACAGCAGCAACAGGG - Intergenic
1160001066 18:75023235-75023257 AGGTTGTTACACAGGTAACATGG - Intronic
1164455006 19:28399609-28399631 AGGCTGATAAAGCTGCAACAAGG - Intergenic
1164469295 19:28515813-28515835 AGGTTGTTCCACTGGAAACAGGG - Intergenic
1165408850 19:35646121-35646143 ACGTGGCTACAGCAGCAACAGGG + Intergenic
925109195 2:1319278-1319300 AGGGAGTTACAGAGGCCACAGGG + Intronic
929047061 2:37800391-37800413 AGGATGTTCCAGTGGCCACAAGG + Intergenic
930434381 2:51321968-51321990 AGGTTTTTACATCTGTAACATGG - Intergenic
930832487 2:55759753-55759775 AGTTTGTTACAGCTGCCAAAAGG - Intergenic
932342713 2:70976773-70976795 AAGTTGCTACAGCAGCAAAATGG - Intronic
938937110 2:136136815-136136837 TGGCTGTTACAGAGGCAAAAAGG + Intergenic
940689725 2:156900586-156900608 ACTTTGTTACAGCAGCAATAGGG + Intergenic
946827138 2:223690573-223690595 ATGGTGTTACAGCAGCCACAGGG - Intergenic
947989346 2:234474474-234474496 AGTTTGTTACAGCAGCAACAGGG + Intergenic
1170152500 20:13239999-13240021 AGGTTGTTACAGGAGCAGAAAGG + Intronic
1181458503 22:23072622-23072644 AGGTTGATGCAGCGAGAACAGGG + Intronic
1184846928 22:47093828-47093850 AGGTTGTTACAGAAACACCAGGG + Intronic
951179924 3:19647569-19647591 AGGTTGTTACAGCAGAAGAAGGG - Intergenic
952174660 3:30848717-30848739 AGAATGTTCCAGCTGCAACAAGG - Intronic
952568941 3:34690496-34690518 ACTTTGTTACAGCTCCAACAAGG + Intergenic
954104765 3:48404034-48404056 AGGATGTGGCAGCAGCAACAAGG + Exonic
956534431 3:70260152-70260174 AGGATGTTTCAGAGGGAACATGG - Intergenic
957292378 3:78294333-78294355 AATTTGTTACAGCAGCAATAGGG - Intergenic
960599635 3:119443252-119443274 TAGTTGTTACAGCAGCAATAGGG + Intronic
962323414 3:134410261-134410283 AGGTTGTTTCAGCAGCTACTAGG - Intergenic
964256140 3:154776653-154776675 AGGTGGTCACAGCAGGAACAAGG + Intergenic
966011435 3:175083201-175083223 AGGTTGTTTCCGGGGGAACAGGG - Intronic
969050661 4:4370661-4370683 AGGTTGTTACAGCGGCAACAGGG + Intronic
969556174 4:7911903-7911925 AGATTGTTCCAATGGCAACACGG + Intronic
970537966 4:17049147-17049169 TAGTTGATACAGCAGCAACAGGG - Intergenic
971881203 4:32375816-32375838 TGGTTGATAAAGCAGCAACAGGG - Intergenic
975025585 4:69544293-69544315 TGGCTGTTACAGCTGCTACATGG + Intergenic
975590000 4:75990510-75990532 AAGGTGTTTCAGCGGCAGCAGGG + Intronic
975651572 4:76598645-76598667 AGGTGGATACAGCTGCACCAGGG - Intronic
978016997 4:103756734-103756756 TGGTTGTTACAGAAGAAACAGGG - Intergenic
985076233 4:186217996-186218018 AAGTTGCTACAGAGGCAGCATGG - Intronic
986254976 5:6094844-6094866 AGGTGGTCAGAACGGCAACAGGG + Intergenic
992166903 5:74061690-74061712 AGGTTTATACAGAGGCCACATGG - Intergenic
994148924 5:96425745-96425767 ATGTTGTTACATTTGCAACATGG - Intronic
994328877 5:98482503-98482525 AATTTGTTACAGCTGCAACAGGG + Intergenic
1000147698 5:158469239-158469261 AATTTGTTACAGCAGCAATAGGG - Intergenic
1002286044 5:178163377-178163399 CAGTTGTTACAGCAGCAATAGGG + Intergenic
1004680296 6:17887340-17887362 AGGTTGTTACTGTTGCATCACGG + Intronic
1008479205 6:51967271-51967293 AGTTTGTGACAGAAGCAACATGG + Intronic
1014283416 6:119466710-119466732 AATTTGTTACAGCAGCCACAGGG + Intergenic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1022904705 7:34844517-34844539 AGGTTGCTAAAGTGGCCACATGG + Intronic
1023470075 7:40508104-40508126 AGTCTGGTACAGTGGCAACAAGG - Intronic
1023617013 7:42029989-42030011 TGTTTGTTGCAGCAGCAACAGGG - Intronic
1024536478 7:50438999-50439021 AGTTTGTTACAGCAGCAATGTGG - Intergenic
1024902804 7:54340849-54340871 ACGTTGGTGCAGCGGCAGCAAGG - Intergenic
1029100155 7:98122872-98122894 AGGATGTTTCGGAGGCAACAGGG - Intronic
1029174571 7:98655595-98655617 AGGTTGTAACAGCAGCATCCTGG + Intergenic
1030708080 7:112715787-112715809 AGGTTGTCACAGAGGCAAACTGG + Intergenic
1033769359 7:144531489-144531511 AATTTGTTACAGCAGCAATAGGG + Intronic
1037057996 8:14468977-14468999 AGGTTATTATAGTGGAAACAAGG - Intronic
1039540501 8:38363824-38363846 AATTTGTTACAGCAGCAACAAGG + Intronic
1042817709 8:72895585-72895607 AATTTGTTACAGCAGCAATAGGG + Intronic
1050970413 9:11864258-11864280 AGGTTGTTTCAGCAGCTACTAGG - Intergenic
1052474221 9:28937833-28937855 AGTTTGTTACATAGGTAACATGG + Intergenic
1186365921 X:8893241-8893263 AGTTTGTTACAGCAGCAATGAGG - Intergenic
1188819970 X:34763120-34763142 AATTTGTTACAGCAGCCACAGGG + Intergenic
1189129046 X:38479388-38479410 AGGTTGTTGGAGAGGCCACAGGG + Intronic