ID: 969053719

View in Genome Browser
Species Human (GRCh38)
Location 4:4388945-4388967
Sequence TAGGCTTTGCAGGAGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 313}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969053704_969053719 20 Left 969053704 4:4388902-4388924 CCAGGCCACGGTGGTGCCACTCT 0: 1
1: 0
2: 1
3: 26
4: 555
Right 969053719 4:4388945-4388967 TAGGCTTTGCAGGAGGGGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 313
969053709_969053719 4 Left 969053709 4:4388918-4388940 CCACTCTGGGCCACTGATGGTCC 0: 1
1: 0
2: 0
3: 27
4: 249
Right 969053719 4:4388945-4388967 TAGGCTTTGCAGGAGGGGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 313
969053712_969053719 -6 Left 969053712 4:4388928-4388950 CCACTGATGGTCCAGGCTAGGCT 0: 1
1: 0
2: 0
3: 6
4: 125
Right 969053719 4:4388945-4388967 TAGGCTTTGCAGGAGGGGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 313
969053703_969053719 21 Left 969053703 4:4388901-4388923 CCCAGGCCACGGTGGTGCCACTC 0: 1
1: 0
2: 0
3: 10
4: 129
Right 969053719 4:4388945-4388967 TAGGCTTTGCAGGAGGGGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 313
969053701_969053719 23 Left 969053701 4:4388899-4388921 CCCCCAGGCCACGGTGGTGCCAC 0: 1
1: 0
2: 0
3: 12
4: 176
Right 969053719 4:4388945-4388967 TAGGCTTTGCAGGAGGGGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 313
969053702_969053719 22 Left 969053702 4:4388900-4388922 CCCCAGGCCACGGTGGTGCCACT 0: 1
1: 0
2: 1
3: 12
4: 143
Right 969053719 4:4388945-4388967 TAGGCTTTGCAGGAGGGGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 313
969053700_969053719 24 Left 969053700 4:4388898-4388920 CCCCCCAGGCCACGGTGGTGCCA 0: 1
1: 0
2: 2
3: 15
4: 217
Right 969053719 4:4388945-4388967 TAGGCTTTGCAGGAGGGGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 313
969053698_969053719 30 Left 969053698 4:4388892-4388914 CCTGTGCCCCCCAGGCCACGGTG 0: 1
1: 0
2: 1
3: 30
4: 302
Right 969053719 4:4388945-4388967 TAGGCTTTGCAGGAGGGGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 313
969053707_969053719 15 Left 969053707 4:4388907-4388929 CCACGGTGGTGCCACTCTGGGCC 0: 1
1: 0
2: 0
3: 10
4: 154
Right 969053719 4:4388945-4388967 TAGGCTTTGCAGGAGGGGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969053719 Original CRISPR TAGGCTTTGCAGGAGGGGCA GGG Intronic
900426237 1:2580693-2580715 TGGGCTTTGCTGGAGGGGGATGG + Intergenic
900570352 1:3355224-3355246 GAGGCCTGGCAGGAGGGGGAGGG + Intronic
901023869 1:6268979-6269001 TGGGCTGTGCACGTGGGGCAGGG + Intronic
901160434 1:7173041-7173063 CAGGCTGTGCGGGAGGCGCAGGG + Intronic
901225596 1:7611378-7611400 TAGGCTGTGCAGGGAAGGCAAGG - Intronic
901323886 1:8355806-8355828 GAGGCCTTGGAGGAGGGGCCAGG - Intronic
902343790 1:15801091-15801113 TAGGCTGGGCAGGAAGGACACGG + Intergenic
902490343 1:16776549-16776571 TACGCTTTGGAGCAGGGCCAAGG + Intronic
906148169 1:43572194-43572216 TAGGCCTTGCAGGGAGGGCCTGG + Intronic
906490782 1:46266838-46266860 AAGGCTCTGGAGGTGGGGCAGGG + Intronic
907393594 1:54174595-54174617 TAGGCTTTGGAAGAGAGGCCAGG + Exonic
908024415 1:59935242-59935264 TAGGGATTGCAGGTGGGGAAAGG + Intergenic
909141523 1:71872517-71872539 TATGCTTTGCTGGAGGGAAAAGG - Intronic
911101172 1:94096866-94096888 TGGGCTTTGCAGGCAGGGCCTGG - Intronic
913960894 1:143337506-143337528 GAGGCCTTGAAGGATGGGCAAGG - Intergenic
914055248 1:144163078-144163100 GAGGCCTTGAAGGATGGGCAAGG - Intergenic
914123898 1:144803283-144803305 GAGGCCTTGAAGGATGGGCAAGG + Intergenic
914730036 1:150362056-150362078 TATGCATTTCAGGCGGGGCACGG - Intergenic
915299551 1:154944304-154944326 TAGGGTTTGTTGGAAGGGCAAGG + Exonic
915440685 1:155943647-155943669 TGGGCTTTGCATTTGGGGCAGGG - Intergenic
915854834 1:159371880-159371902 TATGCTTGGAAAGAGGGGCATGG + Intergenic
919925197 1:202188552-202188574 GAGGCTATGCCAGAGGGGCAGGG - Intergenic
920279848 1:204834558-204834580 GAGGCCTTTCAGGAGGGGCTGGG - Intronic
920433158 1:205931794-205931816 AAGGCTTTGAGGGAGGGGCAGGG + Intronic
920434326 1:205938404-205938426 TAGGCTGGGTTGGAGGGGCATGG - Intronic
920702548 1:208228821-208228843 GAGGCTTTGAAGGATGGGCTGGG - Intronic
922056094 1:222043818-222043840 CAGGCTGGGCAGGAGGGGGAAGG + Intergenic
922183694 1:223256142-223256164 AAGGCTTTGGAGGAGGGAGAGGG - Intronic
922883167 1:228998014-228998036 TACGCTTGACAGGAGGGTCAAGG - Intergenic
923006578 1:230054605-230054627 TGGGCTTTGGAGGATGGGTATGG - Intergenic
923530097 1:234805981-234806003 TACGCTTTGGAGCAGGGCCAAGG - Intergenic
923596944 1:235367675-235367697 AAGGCCTTCCAGGAGGCGCAGGG - Intronic
923885101 1:238146001-238146023 TAGGTGTTGAAGGTGGGGCATGG + Intergenic
924072373 1:240294674-240294696 CAGGCTTTGCAGTGGGGGCAAGG + Intronic
1063185576 10:3647816-3647838 CAGGACTTGCAGCAGGGGCAGGG - Intergenic
1063295487 10:4800897-4800919 CAGGCTGTGCAGGAGGAGGATGG - Intronic
1065609405 10:27457161-27457183 TAGTCTTTACAGAAGGAGCAGGG + Intergenic
1067842438 10:49691744-49691766 CAGGCCCTGCAGGAGGGCCAGGG + Intronic
1068630280 10:59290855-59290877 CAGTATTTGCAGGGGGGGCAGGG + Intronic
1071711524 10:88054367-88054389 TTGGATTTGCAGGAGCGGGAAGG + Intergenic
1071994602 10:91135466-91135488 TAGGCTAAGCAAGAGAGGCAGGG - Intergenic
1072008866 10:91286269-91286291 CAGGGTTTGCAGGAGGAGCAGGG - Intergenic
1073076496 10:100828080-100828102 GAGGCTTCGCTGGAGGGGCTGGG + Exonic
1074375058 10:112933820-112933842 TAGGCATTGCAGGAGGCCCCAGG - Intergenic
1074546466 10:114404987-114405009 TAGGCCTTCCTGGAGGGGCGAGG + Intergenic
1076336520 10:129710238-129710260 AGGGCTTTCCAAGAGGGGCAGGG - Intronic
1076999479 11:315573-315595 TAGGCCCTGTGGGAGGGGCAGGG + Intergenic
1077169760 11:1160899-1160921 TAGGCTCTGAAGGAGCTGCAGGG + Intronic
1077864439 11:6210993-6211015 TAGACCCTGCAGCAGGGGCAGGG - Exonic
1079155730 11:17946216-17946238 TAGGTTTTGCAGTAGGATCAGGG + Intronic
1079319733 11:19442030-19442052 ATGGCTTGGCAGGCGGGGCAGGG + Intronic
1080117205 11:28634331-28634353 TAGGCTTAGAGGGAGGGGTAAGG - Intergenic
1080666867 11:34343976-34343998 TCGGCTGCTCAGGAGGGGCAGGG - Intronic
1081853638 11:46290607-46290629 TGGGGTCTGCAGGAGGGGAAGGG + Intronic
1082785965 11:57316843-57316865 AAGGGTTTGCAGGAGAGGCATGG - Intronic
1083107609 11:60373705-60373727 TAGGCACAGGAGGAGGGGCATGG - Intronic
1083304081 11:61753786-61753808 GTGGCCCTGCAGGAGGGGCAGGG - Intronic
1083894221 11:65612091-65612113 TAGGAAATGCAGGAGGGGCCAGG - Intronic
1084304505 11:68272654-68272676 TAGGCTTTGCAGGCCAGGCGCGG + Intergenic
1084480309 11:69416095-69416117 TGGGCTCTGCAGGAGGGCCAGGG - Intergenic
1086201140 11:84203612-84203634 TATCCTTTGCAGCAGGGACATGG + Intronic
1087849013 11:103006841-103006863 AAGGCTTTTCAGTAGGGGAATGG + Intergenic
1089104248 11:115988995-115989017 TTGGCTTTGCTGGAGATGCAAGG + Intergenic
1089186353 11:116617998-116618020 TTGGCTTGGCAGGCGGGGCGTGG - Intergenic
1091290281 11:134435677-134435699 AAGCCTTTGAAGGAAGGGCATGG - Intergenic
1091470537 12:722487-722509 TCAGGCTTGCAGGAGGGGCAGGG + Intergenic
1093514585 12:19971465-19971487 TAGGGTATGCAGGCTGGGCAGGG + Intergenic
1095237442 12:39814709-39814731 TAGGCCTTGAAGGATAGGCAGGG - Intronic
1095328534 12:40928149-40928171 TTGGCTTTGGTGGTGGGGCAGGG + Intronic
1095879301 12:47115358-47115380 CAGACATTGCGGGAGGGGCAGGG - Intronic
1096306776 12:50484576-50484598 TTGGTTTTGAAGGATGGGCAGGG - Intergenic
1096652196 12:53067372-53067394 GAGGGTCTGCAGGAAGGGCACGG + Intronic
1099088641 12:78278387-78278409 CAGACTTTGCTGCAGGGGCAGGG + Intergenic
1101869172 12:108548526-108548548 TATGCTTTGCAGAAGGGAAAAGG + Intronic
1102655922 12:114482151-114482173 CAGGCTTTGCAGGAGTGCCATGG + Intergenic
1103957627 12:124586863-124586885 TTGATTTTGCAGGAGAGGCATGG + Intergenic
1108522766 13:51260184-51260206 CAGGCTTGGCATAAGGGGCAGGG - Intronic
1113660456 13:112103826-112103848 TACGCTATGCAGGAGGGGGGCGG + Intergenic
1115613646 14:35072440-35072462 TAGGCATGGCAGGAGGTGGAAGG + Intronic
1115809169 14:37087056-37087078 TAAACTTAGCAGGAGGGCCATGG - Intronic
1116648369 14:47559392-47559414 TGCGCTTTGCAGGAGGAACATGG - Intronic
1119520355 14:75280098-75280120 GAGCATTGGCAGGAGGGGCAAGG + Exonic
1120574860 14:86169425-86169447 AAGGCTTTGCAGAAGGGGTCTGG + Intergenic
1120700567 14:87694444-87694466 TGGGCTTTGGAGCAGGGGAAGGG - Intergenic
1121772803 14:96564984-96565006 TAGGATTTGCAGGGAGAGCAGGG - Exonic
1122601582 14:102924267-102924289 AAGGCTTTGGGGGAAGGGCATGG - Intronic
1123701400 15:22917169-22917191 CTGGCTCTGCAGGAGGGTCAGGG - Intronic
1123804242 15:23854844-23854866 TGAGCTTTGCTGAAGGGGCAGGG - Intergenic
1123990001 15:25676085-25676107 TGGGCTCTGCAGCAGTGGCAGGG + Intergenic
1125664329 15:41417690-41417712 GAGGTTTTGGAGGAGGTGCAAGG + Intronic
1126497467 15:49307945-49307967 TAGTCTTTGCAGCATGGGAATGG + Intronic
1128072619 15:64807189-64807211 CAGGCGTTGGGGGAGGGGCATGG - Intergenic
1128270664 15:66306488-66306510 CAGGCTTTGAAGAAGGGGCTAGG + Intronic
1128376811 15:67082407-67082429 TAGGGTTTGAAGTGGGGGCAGGG + Intronic
1129539657 15:76339769-76339791 TGGGCTCTGAAGGAGGGGAAGGG + Intronic
1129678726 15:77646149-77646171 TAGGCCTAGAAGGTGGGGCAGGG - Intronic
1130198882 15:81807086-81807108 TAAGGTTTGCAGGAGTGGAAGGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132239222 15:100244791-100244813 TCGGCGGTGCAGGAGAGGCAAGG - Intronic
1132431698 15:101766440-101766462 TAGACGTTGAAGGAGGGGCTGGG - Intergenic
1132684463 16:1156520-1156542 GAGGCTTTGCAGGAGGCGGCAGG + Intronic
1133239316 16:4405053-4405075 TGGGCTCTGCAAGAGGGACATGG - Intronic
1133372531 16:5256110-5256132 TAAGTTTTGCAGGAGGGGAAGGG + Intergenic
1135251367 16:20902927-20902949 TGGGCTTGGCAGCAGTGGCAGGG - Intronic
1135684646 16:24488970-24488992 TGGGCTTTCCAGGAGAGACATGG - Intergenic
1135804544 16:25530834-25530856 TAGGTTTTGCAGGCTGGGCACGG + Intergenic
1137063584 16:35814144-35814166 TTGACTTGGCAGCAGGGGCATGG - Intergenic
1137694332 16:50451232-50451254 AAACATTTGCAGGAGGGGCATGG - Intergenic
1138848050 16:60591363-60591385 AAGGCTTTTTAGGAGGGTCAGGG + Intergenic
1140507717 16:75484449-75484471 TAGGCCTTCCAGGATGGGAAAGG - Intronic
1141127179 16:81409022-81409044 TAGGCCTTGCAGGACAGGTAAGG - Intergenic
1141343116 16:83221677-83221699 TGGGCTCTGCAGGAGGTGCAGGG + Intronic
1141675329 16:85514463-85514485 TTGGCTCTGGAGGAGGGACAGGG + Intergenic
1142417371 16:89949759-89949781 TGGGCTCTAGAGGAGGGGCAGGG + Intronic
1142743593 17:1943837-1943859 TGGGGTGTGCAGGATGGGCAGGG + Intronic
1143217365 17:5234997-5235019 TAGGCCTTGCGGGAGCGACACGG - Intergenic
1143238639 17:5424850-5424872 TAGGTTTTGTAGGTGGGGGAAGG - Intronic
1144422312 17:15109812-15109834 TAGGCTGAGCGGGAGGGGAATGG - Intergenic
1144729348 17:17517764-17517786 CAGGCTGGGCAGCAGGGGCAGGG - Intronic
1146277018 17:31522601-31522623 TAGGATTTGAAGAAGGGACAAGG - Intronic
1146597336 17:34181588-34181610 GAGGCTGTGCAGGTGGGGCAGGG + Intergenic
1147814908 17:43202215-43202237 TAGAGTATGCAGGAGGAGCATGG - Intronic
1148471181 17:47894520-47894542 TAGGATTTGTAGGAAGGGAACGG + Intergenic
1149445268 17:56708364-56708386 AGGGCTTTGGAGGAGGGGAAGGG - Intergenic
1150566319 17:66344037-66344059 TAGGCTTTCCAGGGGGGCCTTGG + Intronic
1152276267 17:79359490-79359512 TAGCCTTCGAAGGAAGGGCACGG + Intronic
1152571961 17:81124887-81124909 TGGGCTGGGCATGAGGGGCAGGG - Intronic
1154280035 18:12994457-12994479 TAGAGTTTTCAGGAGAGGCATGG + Intronic
1156629669 18:38951711-38951733 CAGGCTTGGCAGGAAGGGCAAGG + Intergenic
1157055839 18:44227492-44227514 GTGACTTTGAAGGAGGGGCAGGG - Intergenic
1157328771 18:46688160-46688182 TAGGCTGTGCAGGGCTGGCACGG - Intronic
1157412611 18:47476362-47476384 GAGGCTTTGCAGGTGGGACAAGG - Intergenic
1157559636 18:48637333-48637355 TAGGGTTTGGTGGAGGGCCAGGG - Intronic
1157953368 18:52065201-52065223 AAGGCTTGGCAGGCCGGGCATGG + Intergenic
1160865206 19:1253190-1253212 CAGCCTTTGCAGGAAGGGCCCGG - Intronic
1161747933 19:6072951-6072973 TAGGGTTTGCAGAAGGTTCAAGG + Intronic
1162529475 19:11227615-11227637 GAGGCTTGACAGGAGGGGCGGGG + Intronic
1163221470 19:15924617-15924639 TGGGCTTTGAAGGATGGGGAGGG - Intronic
1163757063 19:19112451-19112473 TAAACTTGGCAGGAGAGGCAGGG + Exonic
1164397745 19:27880672-27880694 GAGGGTTTGCGGGAGGGGAAAGG - Intergenic
1164912399 19:32023523-32023545 TATGCTTTGCTGCAGGAGCAGGG - Intergenic
1165861517 19:38911747-38911769 CAGGCTGTGCAGGGAGGGCAGGG + Intronic
1166359900 19:42248719-42248741 TAGGGGGTGCAGGTGGGGCACGG + Exonic
1166895026 19:46017538-46017560 TAGGCTTTTTTGGGGGGGCAGGG + Intronic
1167392516 19:49205272-49205294 TAGACGTGACAGGAGGGGCATGG - Intronic
1167676251 19:50887904-50887926 CAGGCTTGGCAGGAGGGCCCAGG + Intergenic
1168703473 19:58455033-58455055 CTGGCTCTGCAGGAGGGGCTGGG - Intronic
1202694730 1_KI270712v1_random:115755-115777 GAGGCCTTGAAGGATGGGCAAGG - Intergenic
925023225 2:588011-588033 TGGGGCTTCCAGGAGGGGCAGGG + Intergenic
925208687 2:2028266-2028288 CAGGCTCTGCAGGAGGAGCCTGG + Intronic
925979880 2:9167951-9167973 TAGGCTTTGCAGCAGAGCCACGG - Intergenic
928082108 2:28320688-28320710 AAGGCTGAGCAGGAAGGGCAAGG - Intronic
928282149 2:29957173-29957195 TAGGATTTGTAGGAGGGTCAGGG + Intergenic
929544398 2:42846240-42846262 TGGGCTGGGCAGGAGGGTCACGG + Intergenic
930112230 2:47688410-47688432 TAGGCCTTGCTGGAGAAGCATGG + Intergenic
931117925 2:59184523-59184545 TGGCCTTTGCATGAGGGGGAGGG + Intergenic
931436188 2:62249141-62249163 TATGGTTTGCAGGCTGGGCATGG - Intergenic
934275901 2:91572803-91572825 GAGGCCTTGAAGGATGGGCAAGG - Intergenic
935266986 2:101403193-101403215 CAGGGTCTGCAAGAGGGGCAAGG - Intronic
935403534 2:102684932-102684954 TAAGCTCTGCAGCAGGGACAGGG - Intronic
935739002 2:106130315-106130337 ATGCCTTTCCAGGAGGGGCAGGG - Intronic
936556058 2:113499606-113499628 CGGGCTTTGCAGGATGGCCATGG - Exonic
936623257 2:114121882-114121904 CAGGCTTGGGAGGTGGGGCAGGG + Intergenic
939928856 2:148207113-148207135 AAGGATGTGCAGGAGGGGCAAGG + Intronic
940189822 2:151028777-151028799 TAGGCTTGGCAGGAGGGTCTAGG - Intronic
943094502 2:183412149-183412171 TAGGCATTGCAGAAAGGGAATGG + Intergenic
948259257 2:236590808-236590830 TAGGCTGTACATGAGGGGCTAGG - Intergenic
1171186060 20:23125278-23125300 TATGCATCGGAGGAGGGGCATGG + Intergenic
1172115546 20:32571586-32571608 TAGGCCTCCTAGGAGGGGCAAGG - Intronic
1172214526 20:33225645-33225667 GAGGCTTTGGAGCAGGGGCTTGG - Intronic
1172610122 20:36244557-36244579 CAGGCTCTGCAGGAGTGACAAGG + Intronic
1173667862 20:44775479-44775501 TAGTCTTTGATGAAGGGGCAGGG - Intronic
1174113830 20:48213789-48213811 GTGGCCTTGCAGGAGGGGCGGGG + Intergenic
1174168013 20:48598742-48598764 GTGGCCTTGCAGGAGGGGCGGGG - Intergenic
1175062257 20:56254354-56254376 AAGGCTTTGGAGGAGGAGCCAGG + Intergenic
1175320188 20:58080052-58080074 CTGGCTTTGCAGGAGGAGAAAGG - Intergenic
1175381258 20:58565995-58566017 CTTCCTTTGCAGGAGGGGCAGGG + Intergenic
1175730311 20:61349816-61349838 TAAGTTTTCCAGGAGGGGAAAGG + Intronic
1175823831 20:61925837-61925859 AAGGCCTTGCAGGGAGGGCACGG + Intronic
1179300497 21:40104779-40104801 GAGGCTGTGCAGTAGGGGCAGGG + Intronic
1181591282 22:23886528-23886550 TAGACATGGCAGAAGGGGCAAGG + Intronic
1183381658 22:37493289-37493311 TAGGCTCTGAAGGGAGGGCAAGG - Intronic
1183395365 22:37568337-37568359 TGGGGTTTGCAGTAGGGGCTGGG - Exonic
1183570704 22:38651224-38651246 TGGGCTTTGCAGAGGAGGCATGG - Intronic
1184559437 22:45253403-45253425 TAGGTTTTGAAGGAAAGGCAAGG + Intergenic
1184891156 22:47380149-47380171 TAGATTTTGGAGGTGGGGCACGG + Intergenic
1185089036 22:48755683-48755705 CAGGCTGTGCAGGAGGTGCCAGG - Intronic
949392390 3:3577497-3577519 TGAGCTTTGCAGGTGTGGCATGG - Intergenic
952840728 3:37643148-37643170 TTGGCTCAGCAGGAGGGGAAAGG + Intronic
953780975 3:45870137-45870159 TCAGCCTGGCAGGAGGGGCAGGG + Intronic
954219058 3:49141582-49141604 GAGGCATAGGAGGAGGGGCATGG - Intergenic
954306215 3:49726832-49726854 TGGGCTTGGCAGCAGGGACAGGG - Exonic
954494616 3:50944666-50944688 AAAGCTTTGTAGGCGGGGCATGG + Intronic
954642729 3:52111354-52111376 GAGGCTCTGCAGGCCGGGCACGG + Intronic
957945844 3:87061756-87061778 TAGGCTTGGAATGAAGGGCAAGG - Intergenic
958434169 3:94077207-94077229 CGGGTGTTGCAGGAGGGGCAGGG + Intronic
959584725 3:108015422-108015444 CAGGGCATGCAGGAGGGGCATGG - Intergenic
961366535 3:126403072-126403094 CAGGTTTCGCAGGAGGGGGAAGG + Intronic
961386483 3:126525915-126525937 CAGGCTCTGCAGGAGAGGGAGGG - Intronic
964218771 3:154320560-154320582 GAGGATTTGCAGGAGGGAGAGGG - Intronic
965101556 3:164305788-164305810 TAGGCTTAGGTGGAGGGGCATGG + Intergenic
967878411 3:194282037-194282059 TGGGCTTTGGAGGAGGCGCCTGG - Intergenic
969053719 4:4388945-4388967 TAGGCTTTGCAGGAGGGGCAGGG + Intronic
969478572 4:7434847-7434869 GAGGCTGGGCAGGAGGAGCAGGG + Exonic
973713504 4:53652352-53652374 AAAGCCTTGCAGAAGGGGCAGGG - Intronic
978616403 4:110600929-110600951 TTGGCTTTGAAAGATGGGCAGGG - Intergenic
979013269 4:115397575-115397597 TAGGGTTTGGTGGTGGGGCAGGG - Intergenic
979179419 4:117707190-117707212 TGGCCTATGCAGGAGTGGCAGGG + Intergenic
981733243 4:147922013-147922035 CAGGAGGTGCAGGAGGGGCAGGG - Intronic
982268757 4:153565176-153565198 GAAGCTCTGCAGGAGGGACAGGG + Intronic
984795217 4:183654034-183654056 TAGGCCTTAAAGGAGAGGCAGGG + Intronic
984839142 4:184051981-184052003 TGGGCCTGGCAGGTGGGGCAGGG + Intergenic
985552076 5:538802-538824 TTGGGCTGGCAGGAGGGGCACGG + Intergenic
985652222 5:1112409-1112431 AAGGGCGTGCAGGAGGGGCAGGG - Intergenic
985681992 5:1260646-1260668 CAAGCTTTGCAGGAGGGGGCTGG - Intronic
988075740 5:26352222-26352244 TATCCTTTGCAGGCTGGGCACGG + Intergenic
989323624 5:40165287-40165309 GAGGCTGTGCAGGAGTGGCCAGG - Intergenic
990122415 5:52471287-52471309 TGGGATTTGCACCAGGGGCATGG + Intergenic
993666132 5:90698804-90698826 AAGCCTTTGCTGGAGAGGCAGGG + Intronic
994170210 5:96651646-96651668 CAGGGTTTGGAGGTGGGGCATGG - Intronic
996702647 5:126465593-126465615 AAGGCGTTACAGGAGGAGCAGGG + Intronic
997511215 5:134455892-134455914 TGGGCTTTGAAGGATGAGCAGGG - Intergenic
998307907 5:141096929-141096951 GCGGCTGTGCAGGAGGAGCAGGG + Exonic
998308543 5:141102782-141102804 GCGGCTGTGCAGGAGGAGCAGGG + Exonic
998310450 5:141124128-141124150 GCGGCTGTGCAGGAGGAGCAGGG + Exonic
998311606 5:141137564-141137586 GCGGCTGTGCAGGAGGAGCAGGG + Exonic
998312889 5:141152384-141152406 GCGGCTGTGCAGGAGGAGCAGGG + Exonic
998315076 5:141174962-141174984 GCGGCTGTGCAGGAGGAGCAGGG + Exonic
998316193 5:141184692-141184714 GCGGCTGTGCAGGAGGAGCAGGG + Exonic
998316755 5:141189451-141189473 GCGGCTGTGCAGGAGGAGCAGGG + Exonic
998317389 5:141194691-141194713 GCGGCTGTGCAGGAGGAGCAGGG + Exonic
998318055 5:141201907-141201929 GCGGCTGTGCAGGAGGAGCAGGG + Exonic
998319016 5:141211040-141211062 GCGGCTGTGCAGGAGGAGCAGGG + Exonic
998320561 5:141225638-141225660 GCGGCTGTGCAGGAGGAGCAGGG + Exonic
998321571 5:141236687-141236709 GCGGCTGTGCAGGAGGAGCAGGG + Intergenic
998322130 5:141242043-141242065 GCGGCTGTGCAGGAGGAGCAGGG + Intergenic
998322794 5:141247711-141247733 GCGGCTGTGCAGGAGGAGCAGGG + Exonic
999103063 5:149043321-149043343 TGGGCATTGGAGGAGGGGCAGGG - Intronic
999400751 5:151262578-151262600 AAGGCTTGGTAGGAGGTGCAGGG - Intronic
1000244095 5:159434624-159434646 AAGGCTTTGCAGGGGTGGGATGG + Intergenic
1000945081 5:167412368-167412390 TAGGGTTAGCAGGCCGGGCAAGG + Intronic
1001272866 5:170328659-170328681 TAGTCATTCCAGCAGGGGCATGG + Intergenic
1001717628 5:173829618-173829640 TGGGCTCGGCATGAGGGGCAAGG - Intergenic
1001931302 5:175674983-175675005 TTGGCTTTGCAGGTGGAGAAAGG - Intronic
1002473315 5:179450397-179450419 AAGGCTTTGCTGGCGGGGAAGGG - Intergenic
1002480911 5:179500256-179500278 GAGGCTTTGCTGGCGGGGAAGGG + Intergenic
1002575595 5:180172150-180172172 TAGGCCAGGCAGGACGGGCAGGG + Intronic
1003092400 6:3115022-3115044 CAGGCTTTGCTGGAGGGGCCTGG + Exonic
1003514561 6:6807140-6807162 TAGTCATGGCAGGAGGGGCTGGG - Intergenic
1004111206 6:12720655-12720677 CTGGATTTGCAGGAGGGGCGGGG + Intronic
1004868715 6:19881030-19881052 AAGGGTTTGCAGGATAGGCAAGG + Intergenic
1005015990 6:21375984-21376006 CAGGCTTTCCAGGAGCAGCATGG + Intergenic
1005051689 6:21689855-21689877 TTGGCTTTGCAGGAGAGTGAGGG + Intergenic
1005107891 6:22245423-22245445 GGGGCTGTGGAGGAGGGGCATGG - Intergenic
1005152091 6:22763560-22763582 TTGGCTTTGCAGTAGGAGCTAGG - Intergenic
1005307203 6:24525311-24525333 AGAGCATTGCAGGAGGGGCATGG + Intronic
1005373036 6:25154769-25154791 TAGGGTATGCAGGATGGGCTGGG - Intergenic
1005937227 6:30532554-30532576 TAGTCTTTGGAGGTGGGGCCTGG - Intergenic
1006212432 6:32408177-32408199 AAGGCTTTGCAGGAGGAGTTGGG - Intergenic
1006515877 6:34545298-34545320 CAGGCTTTCCAGGAGGAGCCAGG + Intronic
1006849777 6:37089939-37089961 TATGCTCTGCAATAGGGGCAGGG + Intergenic
1007722616 6:43894197-43894219 TATGCTCTGCAGGAGTGGCAGGG + Intergenic
1007934931 6:45724515-45724537 TAGGCTTTGTGGTGGGGGCATGG + Intergenic
1009637560 6:66285266-66285288 TAGCCCTTGCTGGAGAGGCAGGG - Intergenic
1011446342 6:87445361-87445383 TGGGGCTTGCTGGAGGGGCAAGG - Intronic
1014574350 6:123052185-123052207 TAGGCTTCCCAGGTTGGGCAGGG + Intronic
1015455529 6:133423129-133423151 GAGGGTTTGCAGGAGGATCAGGG + Intronic
1015953398 6:138576280-138576302 TAGGATTTGCAGGCGGGGAGCGG - Intronic
1019290920 7:249820-249842 CAGGCTGTGCAGCAGGGGCCTGG - Intronic
1019294153 7:265114-265136 TAGGAGGGGCAGGAGGGGCAGGG + Intergenic
1019328347 7:450726-450748 TGGGCTCTGCGGGAGGGGCTGGG - Intergenic
1019608227 7:1920945-1920967 CGAGCTTTGCAGGAGGAGCAGGG - Intronic
1020359883 7:7316440-7316462 TAGCCTGTGCTGGAGGGGGATGG + Intergenic
1021711275 7:23417881-23417903 TAAGCTTTGCAGGAAGGGGTTGG - Intronic
1022467972 7:30664027-30664049 TAGGGTTGGGAGGAGGGGCTTGG - Intronic
1025214616 7:57045564-57045586 TAGTCTTTTCAGGTCGGGCATGG + Intergenic
1026235076 7:68520345-68520367 TTGGCTTTGCAGAAGTGGGAAGG + Intergenic
1026458315 7:70591917-70591939 TAGGCTTCCCAGGAGGCTCACGG + Intronic
1027216295 7:76185953-76185975 TAGGGTTTGCAGCAGGAGCTGGG - Intergenic
1028340723 7:89716624-89716646 TAGTCTTTGGAGGATGGCCAGGG + Intergenic
1029164641 7:98578796-98578818 TTGGCTTTGCTGGCTGGGCAGGG + Intergenic
1029553656 7:101252495-101252517 TCAGCTCTGCAGGAGGGGCGCGG + Intergenic
1029662010 7:101968711-101968733 TAGGCTCTTCAGGCCGGGCATGG - Intronic
1030155255 7:106448342-106448364 GAAGCCTTGCAGGAGGGGTAAGG + Intergenic
1032086543 7:128886800-128886822 TAGGCCTGGCAGGAAGGGAAGGG + Intronic
1032335425 7:131020473-131020495 TAGGCTTTGAAGGAGCAGGAGGG + Intergenic
1032437305 7:131910667-131910689 TAGGTGTAGCAAGAGGGGCAGGG - Intergenic
1032679932 7:134171867-134171889 TAGGTTGTGCAGGAGAGGGAGGG + Intronic
1032745576 7:134783127-134783149 TGGGCCTTGTAGGAAGGGCAAGG + Intronic
1032831216 7:135628453-135628475 TAGGCCTTGCAGGCTGGGCATGG + Intronic
1033131563 7:138749792-138749814 GAGGCTCTGCTGAAGGGGCAGGG - Intronic
1033145950 7:138870139-138870161 AAGGCTTTGCTGGCTGGGCATGG - Intronic
1033483811 7:141768073-141768095 AAGGCTTTGCTGGAAGGGGATGG - Intronic
1034676857 7:152898258-152898280 TGGGATTTGCAGGAAGGGAAGGG - Intergenic
1037082147 8:14800514-14800536 CAGGTTTTGGAGGAGGGGCCTGG + Intronic
1038511194 8:28137404-28137426 TTGCCTTTGCAGGAGTGGAAAGG + Intronic
1039667052 8:39544649-39544671 TAGCCTTTGCTGGAGTGGCTGGG + Intergenic
1042006396 8:64184454-64184476 TATGTTTTGCAGGCTGGGCATGG - Intergenic
1042552721 8:70008508-70008530 AAGGATTTTAAGGAGGGGCAGGG + Intergenic
1043414673 8:80034393-80034415 CAGGCTCTGCAGAAGTGGCAGGG - Intronic
1043645442 8:82511596-82511618 TAGGCTTTCCAGGAGGAACAGGG + Intergenic
1046965988 8:120166195-120166217 TAGACTTTGAAAGATGGGCAGGG + Intronic
1047370182 8:124249746-124249768 TGGGCCTTGCAGCAGGGACAGGG + Intergenic
1047398369 8:124524693-124524715 AAGGTTTTGCAGAAGGGGGAGGG + Intronic
1048293639 8:133198793-133198815 TTGGCTTTGCAGGAGGGTAGGGG - Intronic
1048580937 8:135729375-135729397 TCGGCTTTGTAGGAGAGACAGGG - Intergenic
1048875178 8:138831569-138831591 CATGCTTTGCAGGATGAGCAGGG + Intronic
1049029670 8:140024955-140024977 AAGGCATTCCAGGAGAGGCAGGG + Intronic
1049201658 8:141343447-141343469 GGGGCTTTGCAGAAGGGACAGGG + Intergenic
1049856980 8:144868357-144868379 TAGGTTTTGAAGGGAGGGCAAGG + Intergenic
1049896969 9:117757-117779 CGGGCTTTGCAGGATGGCCATGG + Exonic
1050022102 9:1294845-1294867 CAGGCTTTGCATGAGGCACAAGG + Intergenic
1050634886 9:7601892-7601914 TAGTATTTGCAGGAGTGGAAAGG + Intergenic
1050643269 9:7692118-7692140 TAGGCATGGCAGAAGGGGAAGGG - Intergenic
1052135556 9:24905623-24905645 TAGGCATAGCAGGAGCAGCATGG + Intergenic
1052866939 9:33469659-33469681 TAGGATTTCCTGGAGGGGCCAGG + Exonic
1055941994 9:81659287-81659309 TAGCCTTTGCAAGAGGTGGAAGG - Intronic
1056603965 9:88069746-88069768 TAGCTTGTGCAGGCGGGGCATGG - Intergenic
1056795894 9:89658695-89658717 CAGGCATGGCATGAGGGGCAGGG - Intergenic
1057517599 9:95735228-95735250 AAGTGTTTGCAGGAGAGGCAGGG - Intergenic
1059532485 9:115048507-115048529 TAGGTTTTCCAGAAGGGGCAGGG + Exonic
1059882878 9:118711294-118711316 TAGGATTTGGAGGTGGGGCCTGG - Intergenic
1060610941 9:124963881-124963903 TAGGCTGTGGAGGAGGAGGAGGG + Intronic
1062021037 9:134319547-134319569 CAGGCTTCGCAGGGGAGGCAGGG + Intronic
1062035925 9:134382503-134382525 TTGGCTTTGCTGGACTGGCAAGG + Intronic
1062533128 9:137010444-137010466 TGGGCTCTGGAGGTGGGGCAGGG - Intronic
1185596903 X:1312773-1312795 TGGGGTTTGCAGGAGGGACGTGG - Intergenic
1185953600 X:4464525-4464547 GAGGCTTTCTAGGAAGGGCAGGG + Intergenic
1188979803 X:36716769-36716791 TAGTCTTGGCAGGAGTTGCATGG + Intergenic
1190981327 X:55458764-55458786 TAGGCTTTGTAGGTGGGGAGGGG + Intergenic
1190987371 X:55514416-55514438 TAGGCTTTGTAGGTGGGGAGGGG - Intergenic
1198329147 X:135605745-135605767 TTGGGTTTTCAGGAGGGACATGG - Intergenic
1198364742 X:135929189-135929211 TTGGCATGGCAGCAGGGGCAGGG + Intergenic
1199460125 X:148075067-148075089 CAGGCCTTGTAGGAGAGGCAAGG - Intergenic
1199594273 X:149494191-149494213 AAGGTACTGCAGGAGGGGCAAGG + Intronic
1200153929 X:153965273-153965295 TAGGTGTGGCAGCAGGGGCAGGG - Intronic
1200706122 Y:6444031-6444053 TATGCTTTGCAGGAGGCTCTTGG - Intergenic
1200744337 Y:6890271-6890293 CAGGCTTGGCAGGTTGGGCAGGG - Intergenic
1201027988 Y:9720677-9720699 TATGCTTTGCAGGAGGCTCTTGG + Intergenic