ID: 969054967

View in Genome Browser
Species Human (GRCh38)
Location 4:4396006-4396028
Sequence TCTGAGAGACTCCGCCACAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 71}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969054967 Original CRISPR TCTGAGAGACTCCGCCACAC GGG Intronic
908112634 1:60912245-60912267 TCAGAGAGGCTCCGCCCCAGGGG - Intronic
908817090 1:68045579-68045601 TTTGAGAGACTCCCCCATAAGGG - Intergenic
910399611 1:86825642-86825664 TCTCAGAGAGTCTGCTACACTGG + Intergenic
915104168 1:153522075-153522097 TCGGAGAGGCTCGGCCGCACAGG - Intergenic
918650462 1:186956283-186956305 TTTGAGTGACTTTGCCACACAGG + Exonic
919174514 1:194002139-194002161 TCGGCGAGGCTCAGCCACACAGG - Intergenic
1063262805 10:4409432-4409454 TCTGAGAAATTCCAGCACACTGG + Intergenic
1063693885 10:8314018-8314040 TCAGAGAAACTCTGCCATACTGG - Intergenic
1064369167 10:14736107-14736129 TTTTAGAGACTTTGCCACACAGG - Intronic
1076837900 10:133030262-133030284 ACTGAGAGACCCCGGCACACGGG - Intergenic
1080503043 11:32888274-32888296 TCGGGGAGGCTCCGCCCCACAGG + Intergenic
1084478147 11:69400540-69400562 TCTGAGAGAAACCCCCAAACTGG + Intergenic
1085225374 11:74915363-74915385 ATTGAGAGTCTCCGCCACAGGGG - Intronic
1085319494 11:75565241-75565263 TCTGACAGCCACTGCCACACAGG - Intronic
1091056959 11:132428594-132428616 TCTGAGACCCTCCAGCACACTGG + Intronic
1091938245 12:4450568-4450590 GCTGAGAGACACAGCCACATGGG - Intergenic
1095635791 12:44431767-44431789 TCTAAGAGACTGCGCCGCTCGGG - Intergenic
1096448937 12:51721180-51721202 TCAGTTAGACTACGCCACACTGG - Intronic
1100456940 12:94760898-94760920 TCTTAGATACTCTCCCACACTGG - Intergenic
1109145437 13:58773570-58773592 TCTGGGAGGCTCCGCCGCACAGG - Intergenic
1116452405 14:45080734-45080756 TCTGGGAGGCTCGGCCGCACAGG - Intergenic
1117798238 14:59416605-59416627 TCTGAGAGACTCAGACAGCCAGG - Intergenic
1118740886 14:68738396-68738418 TCTGGGAAACTCAGCCACTCTGG + Intergenic
1122227837 14:100290216-100290238 CCTGAGAGATTCAGCCACCCAGG + Intergenic
1125914507 15:43473935-43473957 TCAGGGAGGCTCAGCCACACAGG + Intronic
1131437141 15:92432087-92432109 TCTCAGAGACTGGGGCACACTGG - Intronic
1132018567 15:98340259-98340281 TCTCAGAGGCTCCTCCCCACAGG - Intergenic
1132385664 15:101398248-101398270 CCCGAGTGACTCCTCCACACTGG + Intronic
1132464358 16:70996-71018 TGTGAGGGCCTCCGCCACACCGG - Intronic
1154945196 18:21156284-21156306 TCAGAGAGTCTCCTCCACTCAGG + Intergenic
1154945842 18:21160553-21160575 TCAGAGAGTCTCCTCCACTCAGG + Intergenic
1155134428 18:22974485-22974507 TTTGAGACTCTCCGCCACCCAGG + Intronic
1161675125 19:5642418-5642440 TCTGTCAGACTCTGCCACCCAGG - Intronic
1164422403 19:28106343-28106365 TCTGAGAGACTCCGACTCCTAGG + Intergenic
1166300738 19:41910784-41910806 CCTGAGACACACAGCCACACTGG + Intronic
1166718823 19:44985983-44986005 GCTTAGAGATTCCGCCACCCAGG - Intronic
928714732 2:34047269-34047291 TCTGAGAAACTCTGCTACAGAGG - Intergenic
931250220 2:60524031-60524053 TTTGAGAGACTCCGGACCACAGG + Intronic
931431885 2:62215064-62215086 TTTGAGAAAATCGGCCACACTGG + Intronic
935421305 2:102871863-102871885 TCTGAGAGGCTGCACCACAACGG + Intergenic
936833062 2:116672350-116672372 AGTGAGAGACTCAACCACACTGG + Intergenic
938093317 2:128447198-128447220 CCTGAGAGTCCCAGCCACACTGG - Intergenic
940025081 2:149197893-149197915 TTTGAGAGTCTCCTTCACACAGG - Intronic
942720748 2:178949707-178949729 TCTCAGAGACTCCTCCTGACAGG - Intronic
948645972 2:239405232-239405254 TCTGAGAGACTCTGTCAAGCGGG + Intergenic
1168967635 20:1908543-1908565 TCTGACATATTCCGGCACACAGG + Intronic
1169471339 20:5888142-5888164 CCTGAGTGACTCTGCAACACGGG - Intergenic
1184803691 22:46777769-46777791 TCGGAGCGGCTCCGCCACCCTGG - Intronic
1184930615 22:47678422-47678444 TCTAAGAGACTTTGACACACAGG + Intergenic
1185043754 22:48518613-48518635 TCTGAGAGAGTCCGCCTCCCAGG - Intronic
1185383646 22:50521762-50521784 TCCCAGAGCCTCCTCCACACAGG - Exonic
950327035 3:12120556-12120578 TCTGAAAGACACAGCCAGACTGG - Intronic
950844504 3:16001530-16001552 TCTGATAGACTCTGCCAGACAGG - Intergenic
952408006 3:33022453-33022475 TCTGTGAGTCTCCACAACACAGG - Intronic
964746820 3:160020354-160020376 TCTGAGAGACTCCGTTTCACAGG + Intronic
965320454 3:167247278-167247300 ACTGACAGACTCTGGCACACTGG + Intronic
969054967 4:4396006-4396028 TCTGAGAGACTCCGCCACACGGG + Intronic
974195071 4:58563560-58563582 CCTCAGAGACTGCGACACACTGG - Intergenic
975184865 4:71389567-71389589 ACTGAAAGACTCTGCCAAACTGG - Intronic
978551358 4:109930697-109930719 TCTGAGGGAGTGCCCCACACAGG - Intronic
986840767 5:11694408-11694430 TTTGAGAGACTCTGTCACCCAGG - Intronic
995314471 5:110752461-110752483 TGTGAGAGACTGAACCACACAGG - Intronic
1000291451 5:159875099-159875121 TCTTAGAGCCTGAGCCACACTGG + Intergenic
1011984033 6:93419618-93419640 GCTGAGAGCCTCCGCCACTCGGG + Intergenic
1012979835 6:105817889-105817911 TCTTAGAAACTGGGCCACACGGG + Intergenic
1014227490 6:118864533-118864555 GCTGAGAGACTCCTACACACTGG + Intronic
1023864543 7:44232571-44232593 TCTGAGAGTGTCGGCCACATGGG + Intronic
1034488810 7:151382069-151382091 TCTCCGAGACTCCGCCCCACGGG + Intronic
1035303586 7:157915694-157915716 TCTGAGAATCTTCTCCACACCGG - Intronic
1040284862 8:46094503-46094525 TGTGAGAGACACAGGCACACTGG - Intergenic
1040295373 8:46146265-46146287 TGTGAGAGACACAGGCACACTGG + Intergenic
1040320258 8:46290809-46290831 TATGAGAGACTCAGGCACCCTGG + Intergenic
1040723030 8:50349517-50349539 ACTGAGAAACTCTGCCAAACAGG - Intronic
1040983048 8:53265546-53265568 TCTGAGAGTCTCTGCCACACAGG - Intergenic
1049096723 8:140552626-140552648 TCTGTGAGACTCTTGCACACAGG - Intronic
1054936474 9:70694082-70694104 TCTGAGAGACTCTGCCATGGAGG + Intronic
1059700918 9:116775033-116775055 TCTCAGTGACTCAGCCACAGTGG - Intronic
1060484629 9:124039446-124039468 TCTGAGAGCTCCGGCCACACTGG - Intergenic
1062154612 9:135039731-135039753 TCTGAGAGATGCCGAGACACTGG + Intergenic
1187736256 X:22306922-22306944 TTTGAGAAACACAGCCACACAGG + Intergenic
1192474973 X:71432750-71432772 TCTGAGATATTCCCCCAAACTGG - Intronic
1196968624 X:121085005-121085027 GTTGAGAGACTCCTACACACCGG - Intergenic