ID: 969057715

View in Genome Browser
Species Human (GRCh38)
Location 4:4412548-4412570
Sequence CAGCTGCCCTTGGCCAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 1, 2: 0, 3: 38, 4: 383}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969057712_969057715 0 Left 969057712 4:4412525-4412547 CCAGGGAGCTGCTGGTCTGTATC 0: 2
1: 0
2: 1
3: 23
4: 169
Right 969057715 4:4412548-4412570 CAGCTGCCCTTGGCCAAAGCTGG 0: 1
1: 1
2: 0
3: 38
4: 383
969057707_969057715 22 Left 969057707 4:4412503-4412525 CCGGAGAAGGCACCTAGGAAGGC 0: 2
1: 0
2: 0
3: 34
4: 184
Right 969057715 4:4412548-4412570 CAGCTGCCCTTGGCCAAAGCTGG 0: 1
1: 1
2: 0
3: 38
4: 383
969057704_969057715 27 Left 969057704 4:4412498-4412520 CCTTTCCGGAGAAGGCACCTAGG 0: 2
1: 0
2: 0
3: 5
4: 63
Right 969057715 4:4412548-4412570 CAGCTGCCCTTGGCCAAAGCTGG 0: 1
1: 1
2: 0
3: 38
4: 383
969057710_969057715 10 Left 969057710 4:4412515-4412537 CCTAGGAAGGCCAGGGAGCTGCT 0: 2
1: 0
2: 2
3: 36
4: 351
Right 969057715 4:4412548-4412570 CAGCTGCCCTTGGCCAAAGCTGG 0: 1
1: 1
2: 0
3: 38
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969057715 Original CRISPR CAGCTGCCCTTGGCCAAAGC TGG Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900610833 1:3543974-3543996 CCACTGCCCATGGCCAGAGCCGG - Intronic
902246156 1:15122178-15122200 CAGCTGGCTTTGGACACAGCTGG + Intergenic
902652183 1:17844192-17844214 CCACTGCCCTTGGACACAGCTGG - Intergenic
903135991 1:21309575-21309597 CACCTGCCATTGTCCCAAGCAGG + Intronic
903285472 1:22274260-22274282 CAGCTGCCATTGGCCAGGCCTGG + Intergenic
903339070 1:22643011-22643033 CAGCTGCCTGCCGCCAAAGCGGG + Intergenic
903993653 1:27291002-27291024 CAGCTGGCCCTGGCAAAATCTGG - Intronic
904702303 1:32365049-32365071 CAGCTGCACTGGGCCAGGGCAGG - Intergenic
905234178 1:36534502-36534524 CAACTTCCCTGGCCCAAAGCTGG + Intergenic
905368642 1:37470638-37470660 GAGCTCCCTATGGCCAAAGCTGG - Intergenic
905487219 1:38310554-38310576 GAGCTCCCAATGGCCAAAGCTGG - Intergenic
905628208 1:39502641-39502663 GAGCTGCCAGTGGCCAAAACTGG + Intronic
905873928 1:41420231-41420253 CAGTCTCCCTTGTCCAAAGCAGG + Intergenic
906285578 1:44585514-44585536 TTGCTGACCTTGGCAAAAGCAGG - Intronic
906415806 1:45620918-45620940 CAGCTGCCCAAGGCTAAGGCTGG + Exonic
907335787 1:53698591-53698613 CACCAGCCCTTGGCCAAGCCAGG + Intronic
908475353 1:64482433-64482455 GAGTTGCCCTTGGCCACTGCAGG + Intronic
910110214 1:83674830-83674852 CAGCTGCCCGTGCTCAAATCTGG + Intergenic
912846156 1:113076291-113076313 CCACTGCGCTTGGCCACAGCCGG + Intronic
913148083 1:116011975-116011997 CACCTGCCCTGAGCCAAAACAGG + Intronic
914331023 1:146671036-146671058 CAGCTGCCCTCTGCCAATGAGGG + Intergenic
916209716 1:162350427-162350449 CAGCTGCCCTTGGCCATCCCTGG + Intronic
916575169 1:166060410-166060432 CAGCTCCCCATGGGCCAAGCAGG + Intronic
917671893 1:177281035-177281057 CAGCTGCCCAGTGCCAAAACTGG + Exonic
920965690 1:210698880-210698902 CAGCTGCCCGTGGCCTCTGCAGG - Intronic
922715944 1:227872098-227872120 CAGCTTCCCTTGGCTAGAGGAGG - Intergenic
923077523 1:230623293-230623315 CAGGTACCCTTGCCCAAGGCTGG + Intergenic
1063042053 10:2352038-2352060 CCGCAGACCTTGGACAAAGCTGG + Intergenic
1063229349 10:4048695-4048717 CATCTGACCTTGGCCCAAGAGGG + Intergenic
1065207999 10:23375286-23375308 CAGCTGTCCTTGGCCATTCCTGG - Intergenic
1067070318 10:43126225-43126247 TAGCTGCCCCTGGCCCAACCCGG - Intronic
1067487709 10:46667181-46667203 GAGCTCCCAGTGGCCAAAGCTGG + Intergenic
1067607097 10:47674823-47674845 GAGCTCCCAGTGGCCAAAGCTGG - Intergenic
1070746829 10:78938818-78938840 CTGCAGCCCTTGGCCAACACTGG + Intergenic
1071547852 10:86541980-86542002 GAGCTCCCAGTGGCCAAAGCAGG + Intergenic
1071556788 10:86610420-86610442 CACATCCCATTGGCCAAAGCAGG - Intergenic
1071622656 10:87136192-87136214 GAGCTCCCAGTGGCCAAAGCTGG - Intronic
1071800171 10:89051134-89051156 GAGCTGCCAATGGCTAAAGCTGG + Intergenic
1073431823 10:103492195-103492217 CAGCTGCAGATGGCCACAGCAGG - Intergenic
1073501150 10:103938301-103938323 CAGCTCCCAGTGGCCAAAGCTGG - Intergenic
1073884126 10:108019097-108019119 CAGCTTCCCTTGGCTAGAGGAGG - Intergenic
1073958983 10:108904325-108904347 CTACTGCCCTGGGCCAAATCTGG + Intergenic
1074228112 10:111507193-111507215 TAGCTGCCCTTTGCCAATTCTGG - Intergenic
1074516707 10:114177013-114177035 GAGCTTCCTGTGGCCAAAGCTGG + Intergenic
1076761289 10:132607105-132607127 GTGCTGCCCTTGGCCGGAGCTGG + Intronic
1077329554 11:1978012-1978034 CAGCTGGCCTGGGCCAAGCCTGG - Intronic
1077364932 11:2157825-2157847 CGGCTGCCCTGGGCCAGAGCTGG - Intronic
1077381316 11:2240089-2240111 GAGCTTCCAGTGGCCAAAGCTGG + Intergenic
1078574297 11:12485524-12485546 GAGCTCCCAGTGGCCAAAGCTGG + Intronic
1079017483 11:16881540-16881562 CTGCTCCCCTTGGCCACAGTGGG - Intronic
1079072413 11:17358841-17358863 GAGCTCCCCGTGGCCAAAGCTGG - Intronic
1079493407 11:21014077-21014099 CAGCCTCCATTTGCCAAAGCTGG - Intronic
1079903326 11:26215382-26215404 CAGCTCCCAGTGGCCAAAGCTGG - Intergenic
1080989670 11:37515873-37515895 GAGTTCACCTTGGCCAAAGCTGG - Intergenic
1081080267 11:38732321-38732343 CAGCTTCCCTTGGCCAGGGGAGG + Intergenic
1081754068 11:45532245-45532267 CAGCTGCCCTTGTCCTAACTGGG + Intergenic
1081936650 11:46908951-46908973 CTTGTGACCTTGGCCAAAGCGGG - Intronic
1083079432 11:60074716-60074738 CAGCTCCCAATGGCCAAAGCTGG - Intergenic
1083385594 11:62306892-62306914 CAGCTTCCCTTGGCTAGAGGAGG + Intergenic
1083603433 11:63962557-63962579 CAGCTGCTCTTGTCCAAATATGG - Intergenic
1083830869 11:65232776-65232798 GAGCTCCCAATGGCCAAAGCTGG - Intergenic
1083898174 11:65630699-65630721 CAGCTTCCCTTGGACAAAACAGG - Intronic
1084522844 11:69675106-69675128 CAGCCGCCCTGGGCCGCAGCCGG + Intronic
1086340416 11:85843001-85843023 CAGATTCCATTGGCCACAGCTGG - Intergenic
1086900411 11:92361269-92361291 CACTTTCCATTGGCCAAAGCAGG + Intronic
1087117413 11:94540618-94540640 CTGCTGTCATTGGCCAAACCTGG - Intergenic
1087600315 11:100306025-100306047 AAGCTGTCCTGGGCCAAGGCTGG + Intronic
1091248020 11:134116503-134116525 GAGCTTCCAGTGGCCAAAGCTGG - Intronic
1202812533 11_KI270721v1_random:33191-33213 CAGCTGGCCTGGGCCAAGCCTGG - Intergenic
1093186681 12:16028298-16028320 GAGCTCCCAGTGGCCAAAGCTGG + Intronic
1093590594 12:20897180-20897202 CTGCTGTCCTTTGTCAAAGCAGG + Intronic
1093937003 12:25012087-25012109 CAGGTGCCCTTGGCAGATGCTGG + Intergenic
1095737024 12:45568747-45568769 CATCAGCCCTTGGCCAGTGCAGG + Intergenic
1096216989 12:49803322-49803344 CTGCTGCCCTTGGCCTCTGCAGG - Intronic
1098848270 12:75564545-75564567 CAGCTGCCCTTGGCAATCTCAGG + Intergenic
1099457884 12:82886106-82886128 GAGCTCCCAATGGCCAAAGCTGG - Intronic
1099949810 12:89289092-89289114 CAGATGGCCTTTGCCAATGCAGG - Intergenic
1101634289 12:106524991-106525013 CAGCTTGTCTTGGCCAAAGAGGG - Intronic
1101808642 12:108088696-108088718 GAGCTTCCAATGGCCAAAGCTGG + Intergenic
1102503410 12:113368541-113368563 CATATCCCATTGGCCAAAGCAGG + Intronic
1102609539 12:114099396-114099418 CAGCTGCCCTCTGCCAGAGAGGG + Intergenic
1102757726 12:115356809-115356831 CAGTTGCCCTCGGGCAAAGAGGG + Intergenic
1103363148 12:120365869-120365891 CAGCTGCCCCTGGGAAAAGCGGG - Intronic
1104993027 12:132636983-132637005 GAGCTGCCCATGGCCAACGTGGG + Intronic
1105445943 13:20457109-20457131 AGGCTGCCCTGGGCCAGAGCTGG - Intronic
1105452651 13:20513972-20513994 GAGCTCCCAATGGCCAAAGCTGG + Intronic
1105812347 13:24006790-24006812 CAGCAGCCCTTGTCAGAAGCTGG - Intronic
1106576761 13:30982001-30982023 CAGCTGCCCTTGTTCATTGCTGG + Intergenic
1106755905 13:32822358-32822380 CACCTGCCATTGACCAAGGCCGG + Intergenic
1107240681 13:38230842-38230864 CCACTTCCCTTGGCTAAAGCTGG - Intergenic
1107383202 13:39878529-39878551 CAGCTGCTCGTGGCTAAGGCAGG - Intergenic
1108646253 13:52431941-52431963 CAGCTCCCACTGGCCAAAGATGG + Intronic
1109024138 13:57139202-57139224 GAGCTCCCGGTGGCCAAAGCTGG + Intergenic
1109025033 13:57145302-57145324 GAGCTCCCGGTGGCCAAAGCTGG + Intronic
1109026020 13:57151872-57151894 GAGCTCCCGGTGGCCAAAGCTGG + Intronic
1109027010 13:57158445-57158467 GAGCTCCCGGTGGCCAAAGCTGG + Intergenic
1109028002 13:57165016-57165038 GAGCTCCCGGTGGCCAAAGCTGG + Intergenic
1109028988 13:57171581-57171603 GAGCTCCCGGTGGCCAAAGCTGG + Intergenic
1109836207 13:67860549-67860571 CAGCTGGCCTGTGCCAGAGCAGG + Intergenic
1109858775 13:68170928-68170950 GGGCTGCCCAAGGCCAAAGCCGG + Intergenic
1110555872 13:76858353-76858375 CAGATCTCATTGGCCAAAGCTGG - Intergenic
1113799205 13:113077845-113077867 CAGCTGACTTTCGCCAAAGCTGG - Intronic
1114377966 14:22169638-22169660 CAGGGTCCCTTGGGCAAAGCTGG - Intergenic
1115270747 14:31549682-31549704 CATCTTCACATGGCCAAAGCAGG + Intronic
1115740451 14:36382072-36382094 CAGCTTCCTTTGGCTAAATCAGG + Intergenic
1115912230 14:38269191-38269213 CAGCTTCCCTTGGCCAGGGGAGG + Intergenic
1117019413 14:51554158-51554180 GAGCTCCCAATGGCCAAAGCTGG + Intronic
1117621885 14:57595690-57595712 GAGCTCGCCATGGCCAAAGCTGG - Intronic
1118470513 14:66070640-66070662 AAGCTTCCCTTGGAGAAAGCCGG + Intergenic
1118635995 14:67749350-67749372 CAGCTGCCTTTGGTCCAAGCAGG - Intronic
1118697668 14:68400343-68400365 CAGCTGCCTTTGGAGAGAGCTGG - Intronic
1119181090 14:72605751-72605773 CAGACCCCCTTGGCAAAAGCCGG + Intergenic
1119510261 14:75205747-75205769 CAGCAGAACGTGGCCAAAGCAGG + Intergenic
1121914880 14:97829640-97829662 CAGCAGCCCATGGCCACCGCTGG - Intergenic
1122403915 14:101486617-101486639 GAGCTCCCAATGGCCAAAGCTGG - Intergenic
1124057595 15:26256460-26256482 GAGCTCCCAATGGCCAAAGCTGG - Intergenic
1124596564 15:31096513-31096535 CAGGTGATGTTGGCCAAAGCAGG - Intronic
1125099973 15:35901244-35901266 CAGCTCCCAGTGGTCAAAGCTGG - Intergenic
1125577900 15:40767617-40767639 CAGCTGCCCCGGGCCGGAGCTGG + Exonic
1126904490 15:53349693-53349715 GAGCTCCCAATGGCCAAAGCTGG + Intergenic
1127953157 15:63829836-63829858 GAGCTTCCAATGGCCAAAGCTGG + Intronic
1128851528 15:70962671-70962693 GAGCTTCCAATGGCCAAAGCTGG + Intronic
1128868282 15:71132950-71132972 CAGCTGCCTTGGCCAAAAGCAGG - Intronic
1129455840 15:75675878-75675900 AAGCCTCCCTTGGCCACAGCGGG + Exonic
1132125235 15:99217904-99217926 TGGCTGCCCTTAGCCAAAGCCGG - Intronic
1132176370 15:99718637-99718659 AAGCTCCTCATGGCCAAAGCTGG - Intronic
1132722786 16:1325150-1325172 GAGCTGCACTTGGCCTCAGCTGG + Exonic
1132861465 16:2073754-2073776 CAGCTTCCATTTCCCAAAGCCGG - Intronic
1133184114 16:4082873-4082895 CAGCTCCCTTTGGCCAAGGCGGG - Intronic
1135135532 16:19883870-19883892 CGGCTGCCCGGGGCCAAGGCGGG + Intronic
1136266714 16:29125520-29125542 GAGCTGCCAATGGCCAAAGCTGG - Intergenic
1138012499 16:53396147-53396169 CAGAGGCCCTTGGCAAAAACTGG + Intergenic
1138510577 16:57506417-57506439 CAGGTGCCCTGGGACAAAGGTGG + Intergenic
1138618208 16:58189241-58189263 CAACTGCGCCCGGCCAAAGCTGG + Intronic
1138853152 16:60654887-60654909 CACCTGGCCTTTGACAAAGCTGG + Intergenic
1139329825 16:66178621-66178643 CAGATGCCCTTGGCCAGCCCTGG - Intergenic
1139872559 16:70119171-70119193 CCACTGCCCTTGGACAAGGCAGG - Intronic
1140002530 16:71039868-71039890 CAGCTGCCCTCTGCCAATGAGGG - Intronic
1140363216 16:74362141-74362163 CCACTGCCCTTGGACAAGGCAGG + Intergenic
1140473786 16:75228692-75228714 CACCTGCCCATGCCCACAGCTGG - Intronic
1141622270 16:85242608-85242630 GAGCAGCCCCTGCCCAAAGCAGG + Intergenic
1142055565 16:87993498-87993520 GAGCTGCCAATGGCCAAAGCCGG - Intronic
1142187202 16:88700235-88700257 CAGCAGCCCTTAGGCAGAGCTGG - Intronic
1142905304 17:3037198-3037220 CTGCTGCCCTTGGCCCTAGTGGG - Exonic
1143563940 17:7710207-7710229 CTGCTGCCCATGGCCTGAGCTGG - Exonic
1143744876 17:8985352-8985374 CAGCTGCCTCTGGCAAAATCTGG + Intergenic
1144416772 17:15055441-15055463 CAGCTTCCAATGGTCAAAGCTGG + Intergenic
1145041926 17:19583359-19583381 CCACTGCCCTTGGCCAAAGGCGG + Intergenic
1145166173 17:20614719-20614741 AAGCTGGGCTGGGCCAAAGCAGG - Intergenic
1146758706 17:35456142-35456164 CAGCTGGTCGTGGCCATAGCTGG - Intergenic
1148863647 17:50617691-50617713 CAGCCTCCCTTGGCAGAAGCTGG - Intronic
1149640315 17:58198701-58198723 AAGGTGCCCTTGCCCATAGCTGG + Intronic
1150369344 17:64623008-64623030 GAGCTCCCAATGGCCAAAGCTGG - Intronic
1150535995 17:66041688-66041710 GAGCTCCCAATGGCCAAAGCTGG + Intronic
1151229180 17:72670671-72670693 GAGCTCCCAATGGCCAAAGCTGG - Intronic
1152229627 17:79107962-79107984 CAGCTGCCCATGGGAACAGCAGG + Intronic
1152323095 17:79619506-79619528 CTGCTGCCCTTGTACAAAGAAGG - Intergenic
1152354169 17:79798618-79798640 CAGTTTCCCTTGGCCAGAGATGG + Intronic
1153767986 18:8392787-8392809 GAGCTCCCACTGGCCAAAGCTGG + Intronic
1154142296 18:11834913-11834935 CAAGTGGCCTTGGGCAAAGCAGG + Intronic
1154309221 18:13254494-13254516 CAGCTGACCATGGGCATAGCTGG + Intronic
1155841039 18:30643028-30643050 GAGCTCCCAATGGCCAAAGCTGG + Intergenic
1156150569 18:34236818-34236840 CAGCTCCCAGTGGCCAAACCTGG - Intergenic
1156381437 18:36565056-36565078 CAGTTGCCCTTGGGGAAAACTGG + Intronic
1156910257 18:42403603-42403625 CAGCTTCCCTTGGAAAAATCGGG + Intergenic
1156911611 18:42417378-42417400 CAGCTGCCCTTTGCCAGTGAGGG + Intergenic
1157564497 18:48670665-48670687 CAGCTTCCCTTTGCCACACCTGG - Exonic
1157635843 18:49153574-49153596 GAGCTCCCAATGGCCAAAGCTGG + Intronic
1160377234 18:78422267-78422289 GAGCTCCCAATGGCCAAAGCTGG + Intergenic
1162938756 19:13995561-13995583 CCACTGCGCTTGGCCAAGGCCGG - Intronic
1166902493 19:46076337-46076359 GAGCTCCCAGTGGCCAAAGCTGG - Intronic
1167019783 19:46864407-46864429 CAATTGCCCTAGGCCACAGCAGG - Intergenic
1167921208 19:52784838-52784860 CAGCTTCTCTAGGCCGAAGCAGG - Intronic
1168635577 19:57993809-57993831 CAGCTGACCCTGGCCCATGCAGG + Intronic
925395185 2:3528531-3528553 CAGCAGCCCGATGCCAAAGCCGG + Intergenic
925544121 2:5000726-5000748 AAGCTCCCAATGGCCAAAGCTGG + Intergenic
925660859 2:6200707-6200729 GAGCTTCCAGTGGCCAAAGCTGG - Intergenic
927463514 2:23320312-23320334 AAGCGGCCATTGGCCAAGGCTGG + Intergenic
927929236 2:27033454-27033476 CAGCTGCCCAGGGCCCTAGCTGG + Intronic
928031405 2:27783055-27783077 AAGCTCCCAATGGCCAAAGCTGG - Intronic
928607131 2:32953368-32953390 CAGCTGCCAATGGCCATAGCAGG - Intronic
928923215 2:36548051-36548073 CAGTTGCCAGTGTCCAAAGCTGG + Intronic
929225588 2:39509037-39509059 AAGCTTCCATTGGCCAAAGATGG + Intergenic
929547206 2:42863465-42863487 CACCTGCCATTGGCCGAGGCTGG + Intergenic
929916704 2:46142573-46142595 CAGCTGCCCTTGGCTATGACTGG - Intronic
930157003 2:48116102-48116124 CAGTAGCCCTTGGCCAAACCAGG - Intergenic
930262935 2:49168762-49168784 TAGGTGAACTTGGCCAAAGCTGG + Intergenic
930660672 2:54049762-54049784 GAGCTCCCAATGGCCAAAGCTGG - Intronic
930786075 2:55272653-55272675 GAGCTCCCAATGGCCAAAGCTGG + Intergenic
931021977 2:58056179-58056201 AAGCTTCTCTTGGCCACAGCTGG - Intronic
933766432 2:85712447-85712469 GAACTGCCCTTGCCCACAGCTGG - Intergenic
934941806 2:98508200-98508222 CTGCTTCCCTTGCCCAGAGCTGG - Intronic
935017899 2:99201593-99201615 CACCTGCCCTTGACTAAAGAGGG + Intronic
935684294 2:105669933-105669955 CTGCTGCTCCTGGGCAAAGCTGG + Intergenic
937027013 2:118707386-118707408 CAGCAGCCCGTGGCCAGGGCAGG - Intergenic
938067145 2:128287339-128287361 CAGCTGTCCCTGCCCACAGCTGG - Intronic
938874494 2:135518488-135518510 CAGCTTCCCTTGGCTAAGGGAGG + Intronic
940417889 2:153443279-153443301 CAGCTTCCGTTGGCTAAAGGAGG + Intergenic
940862719 2:158787252-158787274 TGGCTGCCCTTTGCCAGAGCAGG + Intergenic
942137188 2:172937895-172937917 GAGCTCCCAGTGGCCAAAGCTGG - Intronic
943094614 2:183413823-183413845 CAGCTGGCCTGGGCTAAAGTAGG + Intergenic
944672675 2:202008142-202008164 CAGCTGCCCGAGGCTCAAGCAGG - Intergenic
944987168 2:205190598-205190620 CAGCTGGCCAGGGGCAAAGCTGG - Intronic
945552309 2:211235572-211235594 CAGATGGCCTTGGCCAACTCAGG + Intergenic
946318946 2:218937265-218937287 GAGCTCCCATTGGCCAAATCTGG + Intergenic
946892545 2:224293161-224293183 CATCTGTCCTTGGCCAAAAGAGG + Intergenic
947092124 2:226523876-226523898 CAGCTGACATTGACCAAAGAAGG - Intergenic
947208633 2:227685329-227685351 CATCTTCACGTGGCCAAAGCAGG + Intronic
947983107 2:234426610-234426632 CAGCTGCCCCTGGCCACCGATGG - Intergenic
948031766 2:234823718-234823740 CATCGGCCCTAGGCCACAGCTGG - Intergenic
948260919 2:236603952-236603974 CAGATGACCTTGGAGAAAGCAGG + Intergenic
948535615 2:238644293-238644315 CAGCTGCCCTTGGTGACAGGAGG + Intergenic
1168973273 20:1945520-1945542 CAGCTGACCTTGCCCAGAGAGGG - Intergenic
1170481391 20:16768466-16768488 CAACTGCCCTCGGCCAATGGGGG + Intronic
1170838918 20:19908000-19908022 CAGCTGCTGTTGGCTGAAGCTGG + Intronic
1171104378 20:22418585-22418607 GAGCTCCCAATGGCCAAAGCTGG + Intergenic
1171254087 20:23673202-23673224 CAGTTGCACTTGGGGAAAGCTGG + Intergenic
1171260588 20:23728469-23728491 CAGTTGCACTTGGGGAAAGCTGG + Intergenic
1171269705 20:23804314-23804336 CAGTTGCACTTGGGGAAAGCTGG + Intergenic
1172048845 20:32101110-32101132 CAGCTCCCATTGGCCCAAACTGG + Intronic
1172214450 20:33225257-33225279 CAGCTGCCCCTCCCCAGAGCTGG + Intronic
1172582563 20:36059887-36059909 AAGCTCCCAATGGCCAAAGCTGG + Intergenic
1173052553 20:39577790-39577812 CATCTGCCATTGGACAAACCTGG + Intergenic
1173564425 20:44028842-44028864 TGGCTGCCCTTGGTCACAGCAGG - Intronic
1174464624 20:50707636-50707658 CAGCTGCTCAAGCCCAAAGCCGG - Intergenic
1174484028 20:50850358-50850380 CAGCTGACCAAGGTCAAAGCTGG - Intronic
1174940577 20:54921953-54921975 GAGCTCCCAATGGCCAAAGCTGG - Intergenic
1175186787 20:57184236-57184258 CACATTCCATTGGCCAAAGCAGG + Intronic
1175486119 20:59347687-59347709 GAGCTCCCCGTGCCCAAAGCTGG - Intergenic
1176107890 20:63398133-63398155 CAGCTGCCCCGGGCCATTGCTGG - Intergenic
1176657965 21:9604910-9604932 GAGCTCCCAGTGGCCAAAGCTGG + Intergenic
1178036823 21:28593680-28593702 AAGCTCCCAATGGCCAAAGCTGG + Intergenic
1178432668 21:32530297-32530319 CAGCTGCCATGAGCCAGAGCTGG + Intergenic
1180018366 21:45102628-45102650 GAGCTCCCAGTGGCCAAAGCTGG + Intronic
1180041268 21:45281525-45281547 CAGCTGCCGCTGGCCCCAGCGGG - Intronic
1180109758 21:45642538-45642560 CGGCTGCCCTTGCCCGAGGCCGG + Intergenic
1181161368 22:20961874-20961896 CAGCTGCCCTTGGCTCATGTTGG + Intergenic
1181328761 22:22072339-22072361 CACCTGCAGTTGGCAAAAGCAGG - Intergenic
1181828555 22:25539964-25539986 GAGCTCCCAATGGCCAAAGCTGG - Intergenic
1184028161 22:41873702-41873724 TGGCAGCACTTGGCCAAAGCGGG + Intronic
949581134 3:5389580-5389602 GAGCTCCCAATGGCCAAAGCTGG - Intergenic
950347760 3:12313719-12313741 GAGCTCCCAGTGGCCAAAGCTGG + Intronic
950990005 3:17424325-17424347 CAGCTGCCCTTGGGAAGAGGAGG + Intronic
953334711 3:42084592-42084614 CAGCTTCCCTTGGCTTCAGCCGG + Intronic
953557952 3:43961770-43961792 CAGCTGCCCTAGGCCAGAGACGG + Intergenic
953907358 3:46874972-46874994 GAGCTGCCCTTGGGAACAGCAGG + Intronic
954472115 3:50707056-50707078 CATCTTCACATGGCCAAAGCAGG - Intronic
954926060 3:54235662-54235684 CAGCTCCCAGTGGCCAAAGCTGG + Intronic
958076751 3:88690589-88690611 TAGCTGCCCTTTGGCAGAGCAGG - Intergenic
958891709 3:99790860-99790882 CACATGCCTTTGGCCAAAGATGG + Exonic
960760149 3:121064203-121064225 CAGCTTCCCTTGGCTAAGGTAGG + Intronic
961347984 3:126277177-126277199 CACCTTCACTTGGCCAGAGCAGG + Intergenic
961495928 3:127291371-127291393 GAGCTCCCAATGGCCAAAGCTGG - Intergenic
961618731 3:128206225-128206247 CATCTGCCCTGGGCAAAATCTGG + Intronic
962276564 3:134019029-134019051 CTGCTCCCCTTGGTCACAGCTGG + Intronic
964077603 3:152710611-152710633 GAGCTTCCAATGGCCAAAGCTGG + Intergenic
964366608 3:155957275-155957297 GAGCTCCCAGTGGCCAAAGCCGG - Intergenic
965651801 3:170941826-170941848 CAGCTTCCAATGGCCAAAGCTGG + Intergenic
966840654 3:184084267-184084289 CAGCTTCCCTTGGCCTCAGCGGG + Intergenic
967216624 3:187216157-187216179 GAGCTTCCACTGGCCAAAGCTGG - Intergenic
967466839 3:189816451-189816473 CATCGGCCCTTTACCAAAGCGGG - Intronic
968117985 3:196104284-196104306 AAGCTCCCAATGGCCAAAGCTGG + Intergenic
968443654 4:637139-637161 GAGCTTCCAGTGGCCAAAGCTGG - Intronic
968664582 4:1814144-1814166 CAGCTGGGCTGGGCCAAGGCAGG - Exonic
969057715 4:4412548-4412570 CAGCTGCCCTTGGCCAAAGCTGG + Intronic
969058104 4:4414485-4414507 CAGCTGCCCTTGGCCGAAGCTGG + Intronic
970641532 4:18071558-18071580 GAGCTGCCAATGGCCAAAGTGGG + Intergenic
972196150 4:36656235-36656257 CAGCTTCCCTTGGCCAGAAAAGG - Intergenic
972262000 4:37418200-37418222 GAGCTCCCAATGGCCAAAGCTGG + Intronic
972380975 4:38520122-38520144 GAGCTCCCAATGGCCAAAGCTGG + Intergenic
973660728 4:53103862-53103884 GAGCTCCCAATGGCCAAAGCTGG + Intronic
973954395 4:56049001-56049023 CAGCTGTCCCTGGGCGAAGCCGG + Intergenic
977307485 4:95342769-95342791 AAACTGCCCTGGGCCAAAGGGGG + Intronic
977531401 4:98204734-98204756 CCACTGCCCCTGGCCAAACCAGG - Intergenic
977859633 4:101941131-101941153 CAGCTCCCAATGGCCAAAGCTGG - Intronic
978101828 4:104850819-104850841 GAGCTCCCAATGGCCAAAGCTGG - Intergenic
978614830 4:110584166-110584188 GAGCTCCCAGTGGCCAAAGCTGG + Intergenic
979461673 4:120990927-120990949 CAGCTTCCCTTGGCTAGAGGAGG + Intergenic
979501029 4:121439955-121439977 CTGCTGCCTAGGGCCAAAGCAGG - Intergenic
979593766 4:122510431-122510453 CAGCAGCCCATGGCTAAATCTGG - Intergenic
979629702 4:122886659-122886681 GAGCTCCCAATGGCCAAAGCTGG - Intronic
981087498 4:140699102-140699124 AAGCTCCCAATGGCCAAAGCTGG + Intronic
981266192 4:142786326-142786348 GAGCTCCGTTTGGCCAAAGCTGG + Intronic
982129088 4:152211221-152211243 CCGCTGCACTTGGCCGAAGTAGG - Intergenic
982139355 4:152303092-152303114 GAGCTCCCAATGGCCAAAGCTGG - Intergenic
982284176 4:153717195-153717217 GAGCTCCCAATGGCCAAAGCTGG - Intronic
983048666 4:163017883-163017905 GAGCTCCCAGTGGCCAAAGCTGG + Intergenic
983405489 4:167324234-167324256 GAACTGCCACTGGCCAAAGCAGG - Intergenic
984902878 4:184600602-184600624 CAGCTTCCCTTGGCTACAGGAGG - Intergenic
985314540 4:188642573-188642595 CTCCTGCCCTTCTCCAAAGCAGG - Intergenic
985417445 4:189751167-189751189 GAGCTCCCAGTGGCCAAAGCTGG - Intergenic
985679191 5:1247014-1247036 CAGGCGCCCTTTTCCAAAGCGGG - Intergenic
986666965 5:10112871-10112893 CAGAGGCCCATGTCCAAAGCAGG + Intergenic
986838876 5:11672836-11672858 CAGCTTCCCTTGGCTAGAGAAGG + Intronic
986935321 5:12877073-12877095 CAGCTGCCCTCTGCCAATGAGGG - Intergenic
988328901 5:29809021-29809043 GAGCTCCCAATGGCCAAAGCTGG - Intergenic
988980532 5:36563796-36563818 CAGTGACCCTTGGCCCAAGCTGG + Intergenic
988990031 5:36661678-36661700 CAGCTGTTCTTTGGCAAAGCAGG + Intronic
989090828 5:37729055-37729077 CAGCTTCTATTGGCCAAAGGTGG - Intronic
989764286 5:45061551-45061573 AAGTTGCCAATGGCCAAAGCTGG + Intergenic
990620134 5:57550309-57550331 CAGCTGCCCTTCCCCAACCCTGG + Intergenic
990788251 5:59447797-59447819 CACATGCCATTGGCCAAAGTGGG - Intronic
991278963 5:64888211-64888233 GAGCTACCAATGGCCAAAGCTGG + Intronic
992167798 5:74072101-74072123 CAGCTCCCAAAGGCCAAAGCTGG + Intergenic
993602298 5:89942184-89942206 GAGCTCCCATTGGCCAAATCTGG + Intergenic
994113706 5:96038157-96038179 GAGCTCCCAATGGCCAAAGCTGG + Intergenic
995068208 5:107886630-107886652 AAGCTGCCAGTGACCAAAGCTGG + Intronic
995687679 5:114788805-114788827 CAGCAACCCCTGGCCACAGCTGG - Intergenic
996040696 5:118806954-118806976 GATGTTCCCTTGGCCAAAGCAGG - Intergenic
997512316 5:134462159-134462181 GAGCTGTCATTGGCCCAAGCAGG + Intergenic
999232061 5:150067380-150067402 CAGTTGCCCTTGTCTACAGCTGG - Intronic
1000996171 5:167960930-167960952 CAGCTTCCCTTGGCTAGAGGAGG + Intronic
1001517366 5:172365369-172365391 CAGCTGGCTATGGACAAAGCTGG + Intronic
1003428623 6:6018208-6018230 GAGCTCCCATTGGTCAAAGCTGG - Intergenic
1003454756 6:6271417-6271439 CAGCTATCCTTGGCCCAATCTGG + Intronic
1004022758 6:11789691-11789713 CAGCAGGCCTTGGCCAGAGAGGG - Intronic
1004094142 6:12536030-12536052 CATCTGCTCTTGGCCAATGGTGG - Intergenic
1004205960 6:13592064-13592086 CAGCTGCCTTTGGCCATGGGAGG + Intronic
1004901146 6:20195318-20195340 CTGCTGTCAGTGGCCAAAGCTGG - Intronic
1006274960 6:32997022-32997044 GAGCTTCCATTGGCCAAAACTGG - Intergenic
1006673170 6:35742737-35742759 CAGCTGCCCATGGGGAAGGCAGG - Intronic
1006844131 6:37050925-37050947 CAGCTGCCCTTGGATATATCAGG - Intergenic
1006885960 6:37382545-37382567 CAGCTGATCTTGGCCAAATCTGG - Intronic
1007391149 6:41550029-41550051 CAGCTTCCCTAGACCAAGGCAGG + Intronic
1007607544 6:43127597-43127619 AAGCTGACCTTGGCCACAGATGG + Intronic
1008182864 6:48354752-48354774 GAGCTCCCAATGGCCAAAGCTGG - Intergenic
1008914832 6:56775721-56775743 GAGCTCCCAATGGCCAAAGCTGG + Intronic
1009948174 6:70364290-70364312 CAGCTGCCTTTTGCCAGAGAGGG + Intergenic
1010027502 6:71236937-71236959 CACCTGCCCTTGGTCTCAGCAGG + Intergenic
1011298995 6:85854134-85854156 CAGCTCCCCTTGGCTAAGGGAGG + Intergenic
1012365965 6:98440985-98441007 GAGCTCCCACTGGCCAAAGCTGG + Intergenic
1012457436 6:99423200-99423222 GAGCTGCCAATGGCCAAAGCTGG + Intronic
1013145771 6:107389970-107389992 GAGCTCCCAATGGCCAAAGCTGG + Intronic
1013181344 6:107719302-107719324 CAGCTTCCCCTGGCCAAGGATGG - Intronic
1014177097 6:118342774-118342796 CAGCTTCCCTTGGCTAAGGGAGG + Intergenic
1014701517 6:124694591-124694613 CAGCTGCTCTTGAACAAAGCAGG + Intronic
1014860928 6:126467527-126467549 AAGCTTCCAATGGCCAAAGCTGG + Intergenic
1015023771 6:128508613-128508635 CAGTTGCCCTTGGCCAACTGTGG + Intronic
1015169927 6:130241050-130241072 CAGTAGCCCCTGGCCAAAGGAGG + Intronic
1016360442 6:143261501-143261523 CTGGTGGCCTTGGCCTAAGCAGG + Intronic
1017059455 6:150468683-150468705 GAGCTCCCAGTGGCCAAAGCTGG - Intergenic
1018098776 6:160417724-160417746 AACCTGCCATTGGCCAAAGCAGG - Intronic
1018654720 6:166024418-166024440 CAGCTGCTCTGGGCCCCAGCAGG + Intergenic
1020026282 7:4902337-4902359 CTCCTGCCCTTGGCCAGACCTGG - Intergenic
1020693889 7:11391828-11391850 CAGCTTCCCTTGGCTAGGGCAGG + Intronic
1021563985 7:21998797-21998819 GAGCTCCCAATGGCCAAAGCTGG + Intergenic
1022615565 7:31926699-31926721 CAGCTTCCCTTGGCTAGAGGAGG - Intronic
1023110527 7:36806504-36806526 CAGCTCCCCTTGGCCAAGGACGG + Intergenic
1023869227 7:44254045-44254067 CATCTGGCCTGGGCCACAGCAGG + Intronic
1024770318 7:52714312-52714334 CCTCTGCCCCTGGCCAAGGCTGG + Intergenic
1025607183 7:63047769-63047791 CAGCAGGCCTGGGGCAAAGCAGG - Intergenic
1026477529 7:70749682-70749704 CAGGTCCCCTGGGCCATAGCAGG + Intronic
1028390712 7:90313586-90313608 GAGCTCCCAGTGGCCAAAGCTGG + Intergenic
1028597150 7:92557690-92557712 AAACTGCCAATGGCCAAAGCCGG - Intergenic
1029229174 7:99052168-99052190 CAGATGGCATTGGCCACAGCAGG + Intronic
1029253419 7:99252724-99252746 CAGCAACCCTTGGCCAACTCTGG + Intergenic
1029727586 7:102417547-102417569 GAGCTCCCAATGGCCAAAGCTGG - Intronic
1029746375 7:102517694-102517716 GAGCTGCGCTTGGCCATCGCGGG + Exonic
1029764313 7:102616673-102616695 GAGCTGCGCTTGGCCATCGCGGG + Exonic
1029845320 7:103406412-103406434 CAGCTTCCCTTGGCTAAGGGAGG + Intronic
1031739055 7:125404856-125404878 GAGCTACCAATGGCCAAAGCTGG - Intergenic
1032582084 7:133112798-133112820 CAGTTGCCCAAGACCAAAGCTGG + Intergenic
1032728674 7:134616091-134616113 AAGCAGGCCTTGGCCAAAGACGG - Intergenic
1033570914 7:142627443-142627465 CAGCTGCCCTCCGCCCCAGCGGG + Intergenic
1034408110 7:150919726-150919748 GAGCTTCCAGTGGCCAAAGCTGG - Intergenic
1034727189 7:153347836-153347858 GAGCTTCCACTGGCCAAAGCTGG - Intergenic
1034998590 7:155593950-155593972 CAGCTGCCCTTGGCCTTGGCGGG - Intergenic
1036133660 8:6139393-6139415 CATTTGACCTTGGCCAGAGCAGG - Intergenic
1036587365 8:10136697-10136719 CAGCTGCCCTGAGGCAAGGCAGG + Intronic
1037743381 8:21624703-21624725 CAGGTCCCCAAGGCCAAAGCTGG + Intergenic
1038106796 8:24444137-24444159 GAGCTCCCGATGGCCAAAGCTGG + Intronic
1039002732 8:32999329-32999351 GAGCTCCCAATGGCCAAAGCTGG - Intergenic
1039294869 8:36139464-36139486 CACCTGCTCTTGATCAAAGCTGG + Intergenic
1039552222 8:38451418-38451440 CAGCTGCCTTTGGCCCAAAGGGG - Intronic
1040573421 8:48629102-48629124 GTGCTGCCCGTGGACAAAGCTGG - Intergenic
1040573594 8:48630848-48630870 TAGCTCCCATTGGACAAAGCTGG - Intergenic
1040626119 8:49151644-49151666 CAGCTGCAGCAGGCCAAAGCTGG + Intergenic
1043511268 8:80952581-80952603 CAGCTTCCCTTGGCTAAAGGAGG - Intergenic
1044886927 8:96789609-96789631 CATTTGGCCTTGGCCAAAGTTGG - Intronic
1045542653 8:103101344-103101366 AAGCTTCCCTTGCCCAAAGCAGG - Intergenic
1048134813 8:131738251-131738273 CAGCTGGCCTAGGCCAATGCTGG + Intergenic
1048528982 8:135230197-135230219 CAGCTGGCTTAGGCGAAAGCAGG + Intergenic
1048961177 8:139579638-139579660 CAGATTCCCTTGGCAAAGGCTGG - Intergenic
1049340349 8:142109086-142109108 CAGCGGCCCTAGGCCAGAGAGGG + Intergenic
1049397409 8:142407691-142407713 CAGCCCCCCTTGGCCACAGCTGG + Intergenic
1049734781 8:144199214-144199236 CAGATGCCCATGGGCAAAGCTGG - Intronic
1049919663 9:351478-351500 CAGCTGCCCATTGGCAAATCAGG + Intronic
1051877411 9:21806728-21806750 CACCTGCCCTTGGCTGATGCTGG - Intronic
1051961412 9:22768552-22768574 GAGCTCCCATTGTCCAAAGCTGG - Intergenic
1052295474 9:26892606-26892628 CTGCTGCCGCTGGCCAACGCGGG + Exonic
1055210251 9:73782950-73782972 CAGCTTCCCTTGGCTAGAGGAGG - Intergenic
1055785412 9:79864847-79864869 CAGTTTGCCTTGGCCAAATCAGG - Intergenic
1057301560 9:93888639-93888661 CAGCTTCCAATGGCCAAAGCTGG + Intergenic
1057841917 9:98493161-98493183 GAGCTCCCAATGGCCAAAGCTGG - Intronic
1057911069 9:99021111-99021133 CTGCTGCCTATGGCCAGAGCAGG - Intronic
1059193787 9:112351757-112351779 GAGCTCCCAATGGCCAAAGCTGG - Intergenic
1061751730 9:132782870-132782892 CCGCTGCCCTGGGCCTAAACAGG + Intronic
1062071599 9:134558202-134558224 GAGCTCCCAGTGGCCAAAGCTGG + Intergenic
1062689200 9:137832756-137832778 GAGCTGCCCCTGGTGAAAGCTGG + Intronic
1203635694 Un_KI270750v1:108485-108507 GAGCTCCCAGTGGCCAAAGCTGG + Intergenic
1186253242 X:7691792-7691814 CACCTGCCCTTAGCCATAACAGG - Intergenic
1186473071 X:9836226-9836248 CAGCTGCCCTTGGGTAAAAGTGG + Intronic
1186858301 X:13646813-13646835 CAGCGGCCCATTTCCAAAGCTGG - Intergenic
1188253338 X:27927528-27927550 CAGCTTCCGTTGACCAAATCTGG - Intergenic
1188581357 X:31717905-31717927 CTGTTGCCCTGGGCCACAGCTGG - Intronic
1189122007 X:38404970-38404992 CTGCTGCCCTTGACCAATGCTGG - Intronic
1189210875 X:39280935-39280957 CAGCTTCCCTTGGCTAGAGGAGG + Intergenic
1189429044 X:40931144-40931166 CAGCAGCCCTCAGCCAAAGATGG - Intergenic
1190124276 X:47689678-47689700 GAGCTCCCCATGGCCAAAGCTGG - Intergenic
1190295287 X:49023222-49023244 CAACTCCCAATGGCCAAAGCTGG - Intergenic
1191060362 X:56289198-56289220 GAGCTCCCAATGGCCAAAGCTGG - Intergenic
1191788833 X:64946328-64946350 CAGCTTCCCTTGGCTAGAACAGG + Intronic
1192446314 X:71214165-71214187 CAGCTTCCCTTAGCCAAACCTGG - Intergenic
1193227211 X:78998306-78998328 CAGCTAGACTTGGCCTAAGCAGG + Intergenic
1193949265 X:87778321-87778343 CAGCTTCCCTTGGCTAAGGGAGG - Intergenic
1195746412 X:108123042-108123064 CAGAGTCCCTTGGCCAAAACTGG + Intronic
1196379040 X:115069110-115069132 CAGCTGCCCTTGGCCCTTGAGGG - Intergenic
1196571215 X:117268276-117268298 CGGCTTCCCTTGGCTAAAGGAGG - Intergenic
1198778305 X:140205521-140205543 GAGCTCCCAATGGCCAAAGCTGG - Intergenic
1199420791 X:147642221-147642243 CAGCTCCCGGTAGCCAAAGCTGG + Intergenic
1200153499 X:153963181-153963203 CAGCAGCCATGGGACAAAGCGGG - Intronic
1201470041 Y:14323041-14323063 CACCTGCCCTTAGCCAAAACAGG - Intergenic