ID: 969060452

View in Genome Browser
Species Human (GRCh38)
Location 4:4429824-4429846
Sequence ACTCCCAGTGGCTGGCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 248}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969060452_969060466 29 Left 969060452 4:4429824-4429846 CCTGCCAGCCAGCCACTGGGAGT 0: 1
1: 0
2: 1
3: 27
4: 248
Right 969060466 4:4429876-4429898 CTTGGAAGACGCCTTTCATGTGG 0: 1
1: 0
2: 1
3: 2
4: 87
969060452_969060460 4 Left 969060452 4:4429824-4429846 CCTGCCAGCCAGCCACTGGGAGT 0: 1
1: 0
2: 1
3: 27
4: 248
Right 969060460 4:4429851-4429873 ACAGGCCTACCTCAGGGGACAGG 0: 1
1: 0
2: 0
3: 14
4: 147
969060452_969060461 5 Left 969060452 4:4429824-4429846 CCTGCCAGCCAGCCACTGGGAGT 0: 1
1: 0
2: 1
3: 27
4: 248
Right 969060461 4:4429852-4429874 CAGGCCTACCTCAGGGGACAGGG 0: 1
1: 0
2: 3
3: 27
4: 205
969060452_969060457 -3 Left 969060452 4:4429824-4429846 CCTGCCAGCCAGCCACTGGGAGT 0: 1
1: 0
2: 1
3: 27
4: 248
Right 969060457 4:4429844-4429866 AGTTTCTACAGGCCTACCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 93
969060452_969060463 11 Left 969060452 4:4429824-4429846 CCTGCCAGCCAGCCACTGGGAGT 0: 1
1: 0
2: 1
3: 27
4: 248
Right 969060463 4:4429858-4429880 TACCTCAGGGGACAGGGCCTTGG 0: 1
1: 0
2: 2
3: 24
4: 262
969060452_969060458 -2 Left 969060452 4:4429824-4429846 CCTGCCAGCCAGCCACTGGGAGT 0: 1
1: 0
2: 1
3: 27
4: 248
Right 969060458 4:4429845-4429867 GTTTCTACAGGCCTACCTCAGGG 0: 1
1: 0
2: 0
3: 7
4: 106
969060452_969060459 -1 Left 969060452 4:4429824-4429846 CCTGCCAGCCAGCCACTGGGAGT 0: 1
1: 0
2: 1
3: 27
4: 248
Right 969060459 4:4429846-4429868 TTTCTACAGGCCTACCTCAGGGG 0: 1
1: 0
2: 0
3: 17
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969060452 Original CRISPR ACTCCCAGTGGCTGGCTGGC AGG (reversed) Intronic
900126333 1:1070471-1070493 ACTCCCAGGGCCAGCCTGGCTGG - Intergenic
900294538 1:1942451-1942473 GCACCCAGGGGCTGCCTGGCAGG - Intronic
901077561 1:6564868-6564890 ACTCCCAGGGGAGGACTGGCAGG - Intronic
901638496 1:10681367-10681389 CCTCACATGGGCTGGCTGGCAGG - Intronic
902396578 1:16135185-16135207 TCTCCCTGTGGGTGGGTGGCCGG + Exonic
905142137 1:35855867-35855889 ACTCTTGGTGACTGGCTGGCTGG + Exonic
905938102 1:41840740-41840762 TCGTCCAGTGACTGGCTGGCTGG - Intronic
908317860 1:62951592-62951614 ATTCTGACTGGCTGGCTGGCTGG + Intergenic
909795608 1:79731949-79731971 ACTCCCAGTTCCTGCCTGGGTGG + Intergenic
910132160 1:83920881-83920903 CCACCCAGAGGCTGGCTAGCAGG + Intronic
911766457 1:101681427-101681449 ACTACCAGTGGCAGTCAGGCAGG - Intergenic
912593842 1:110854220-110854242 TATCTCTGTGGCTGGCTGGCTGG + Intergenic
914431322 1:147622292-147622314 ATTCACAGAGGCAGGCTGGCTGG - Exonic
914903078 1:151722337-151722359 ACACCCAGTGGATGGCTGTTGGG - Intronic
914928570 1:151909587-151909609 ACTACTGGCGGCTGGCTGGCCGG + Exonic
915025425 1:152825618-152825640 ACTCCCAGTGGCTAAGTGGTGGG + Intergenic
915236962 1:154490962-154490984 TCTCACTGTGGCTGGTTGGCTGG - Intronic
915475870 1:156152539-156152561 TCTCCCAGAGGCTGGTTGCCAGG - Intronic
915734988 1:158078820-158078842 TCCCCCAGTGGGTGGCTGCCTGG - Intronic
918039726 1:180906686-180906708 ACTCCCCCAGGCTGGCAGGCAGG - Intergenic
918042805 1:180923483-180923505 ACACCCAGTGGCCAGCTCGCAGG - Intronic
918404664 1:184199977-184199999 ACTTCATGTGGTTGGCTGGCTGG + Intergenic
919100137 1:193085847-193085869 ATTCCTAGTGACTGGCTAGCTGG - Exonic
922723456 1:227910638-227910660 ACTCACACAGGCTGGCTGTCAGG + Intergenic
922883861 1:229003296-229003318 ACTCCCAGAGGCTCGCCCGCAGG - Intergenic
1063148970 10:3320102-3320124 ACTCTGAGCGGCTGGCCGGCCGG - Intergenic
1064953053 10:20875737-20875759 AGACCCCATGGCTGGCTGGCTGG - Intronic
1065981579 10:30903072-30903094 ACTGGGAGCGGCTGGCTGGCCGG - Intronic
1069119736 10:64555164-64555186 ACTCCCATTGGCTGGTTAGAGGG + Intergenic
1069814858 10:71187227-71187249 ACCCCCAGTGCCTGGATGTCCGG - Intergenic
1072640558 10:97208001-97208023 AGACTCAGTGTCTGGCTGGCTGG - Intronic
1073131185 10:101190154-101190176 ACTCCCAGTGGGTGGGGGCCGGG + Intergenic
1073480708 10:103784626-103784648 ACTGGCAGCGGCTGGCTGGAGGG + Intronic
1075440566 10:122476583-122476605 ACGGCCAGTCGCTGGGTGGCAGG - Intronic
1075810668 10:125222523-125222545 ACTCCCAGTAAGTGGATGGCTGG + Intergenic
1076212739 10:128661875-128661897 AAGCCCAGAGGCTAGCTGGCTGG - Intergenic
1076329240 10:129652735-129652757 CCTCCCAGAGGCAGGCAGGCCGG - Intronic
1076844128 10:133060710-133060732 ACCACCTGTGGCCGGCTGGCCGG + Intergenic
1076998047 11:308650-308672 GCTCCAGGAGGCTGGCTGGCTGG + Intronic
1076999268 11:314569-314591 GCTCCAGGAGGCTGGCTGGCTGG + Intronic
1077000597 11:320331-320353 GCTCCAGGAGGCTGGCTGGCTGG - Intronic
1077097146 11:803891-803913 ACCCCCAGTGTGGGGCTGGCTGG - Intronic
1080545197 11:33310199-33310221 AATCACTGTGGCTGGCTGGCTGG + Intronic
1080938131 11:36884264-36884286 ACTATCAGTGGATGGCTGGATGG - Intergenic
1081733915 11:45390701-45390723 ACCACCAGTGGCTGGCAGGGTGG + Intergenic
1083018158 11:59477858-59477880 GCTCACAGTGGCTGCCTGGTTGG + Exonic
1083019461 11:59492080-59492102 GCTCACAGTGGCTGCCTGGTTGG + Intergenic
1083714321 11:64567114-64567136 ACTCCCAGGGGCTGGGGGACAGG + Intronic
1084192679 11:67505921-67505943 ACTCCGGGTGGCTGGGTGACCGG - Intronic
1084493308 11:69489802-69489824 CCTCCCAGGGGCTGGCAGGCTGG + Intergenic
1085957017 11:81410825-81410847 ACTCTCAGTGGCAGGATGCCTGG - Intergenic
1086500388 11:87446839-87446861 GGTCCCTCTGGCTGGCTGGCTGG + Intergenic
1086865592 11:91976047-91976069 TTTCCCAGTGGCTGCCTGGAGGG + Intergenic
1087204533 11:95380205-95380227 ACTACCAGTGCCTAGGTGGCAGG + Intergenic
1088991051 11:114953971-114953993 GCTCCCAGGAGCTGGCTGTCAGG + Intergenic
1089731285 11:120520648-120520670 CCTCCAAGGGCCTGGCTGGCTGG + Intronic
1091602192 12:1924689-1924711 CCTCCCAGCGGCTGCCTGCCTGG - Intergenic
1091760513 12:3084281-3084303 ACCCCCACTGTCTGGCTGCCTGG - Intronic
1091979384 12:4853199-4853221 GCTCCCAGAGGCTGGCCTGCGGG + Intergenic
1093510194 12:19917623-19917645 CTTCCAAGTGGCTGGCAGGCAGG + Intergenic
1094507090 12:31071426-31071448 ACTGCCCGGGGCTGGCGGGCCGG - Intergenic
1095891512 12:47239058-47239080 ACTCCCAGTGGGTGGAGGGGTGG - Intergenic
1096230056 12:49891805-49891827 ACGTCCAGTGGGAGGCTGGCAGG + Intronic
1096718741 12:53506036-53506058 ACACACAGTGGCCGGCTGGGTGG - Exonic
1100278208 12:93091893-93091915 ACTCCCAGAAGCTGTCTGGAAGG - Intergenic
1100407734 12:94285771-94285793 TCTCCCTGTGTCTGGGTGGCAGG + Intronic
1102434682 12:112911654-112911676 CCTCCCACTTACTGGCTGGCTGG + Intronic
1104015659 12:124960095-124960117 ACACCCAGGGGATGGCTGTCTGG - Intronic
1104771242 12:131366169-131366191 ACAGGCAGTGGCTGGCTGGGGGG + Intergenic
1105431358 13:20340324-20340346 CCTCCCAGGGGCTGGAGGGCAGG - Intergenic
1105584853 13:21734626-21734648 ACTCCCAGTGGCAAACTGGCAGG + Intergenic
1107623506 13:42258903-42258925 TCTCCCAGTGGCAGGTGGGCTGG - Intergenic
1111775982 13:92662559-92662581 ATTTTGAGTGGCTGGCTGGCGGG - Intronic
1113942797 13:114027160-114027182 AATCCCCAGGGCTGGCTGGCTGG + Intronic
1119535636 14:75400530-75400552 GTTCCCAGTGGCTGGCTCCCTGG - Intergenic
1119871487 14:78021750-78021772 ACACAGACTGGCTGGCTGGCTGG + Intergenic
1122503202 14:102215404-102215426 TCTCCCAGCTGCTGGCTGGGTGG - Intronic
1122548113 14:102535992-102536014 GCTCCCAGGGCCTGGCTGCCAGG - Intergenic
1125756004 15:42065432-42065454 ACTCTCCTTGGCTGTCTGGCTGG + Intergenic
1127565532 15:60184578-60184600 TCTCTCACTGGCAGGCTGGCAGG - Intergenic
1127937798 15:63659792-63659814 GCTCCCAGTGGATCGCTGTCAGG + Exonic
1128479477 15:68024864-68024886 GCTGCCCATGGCTGGCTGGCTGG + Intergenic
1128886607 15:71293901-71293923 CCTCCCAGTGGCTGCCTGGGGGG + Intronic
1132657818 16:1048663-1048685 ACTCACAGGGGCGGGCTGGGCGG + Intergenic
1132679570 16:1134216-1134238 ACTCCAACTGCCTGGCAGGCGGG - Intergenic
1132993294 16:2808536-2808558 GCTCCCAGTGCCTGCCTGCCTGG + Intergenic
1134106230 16:11487372-11487394 ACTCCTAGTGTCTGGCAGCCTGG - Exonic
1136105051 16:28024429-28024451 ACTCCCAGTGGCTCGTTGCTTGG - Intronic
1136288152 16:29256100-29256122 GCTCCCAGTGTCTGGGTGGACGG + Intergenic
1138107734 16:54298616-54298638 ACTGGCAGTGCCAGGCTGGCAGG + Intergenic
1141014999 16:80440929-80440951 AATCCCAGTGGCTGGCTCTAAGG + Intergenic
1141184049 16:81774497-81774519 AGTCCCAGCTGCTGGCTGGCAGG - Intronic
1141476895 16:84280061-84280083 GCTCCCAGCCGCTGCCTGGCCGG - Intergenic
1142093824 16:88228867-88228889 GCTCCCAGTGTCTGGGTGGACGG + Intergenic
1142865914 17:2791382-2791404 ACCCCCAATGCCTGGCTGGACGG - Intronic
1142992034 17:3737913-3737935 ACCCCCAGTAGCTGGCTGGGAGG + Intronic
1143028225 17:3953313-3953335 ACTACCACAGGATGGCTGGCAGG + Intronic
1143118711 17:4594653-4594675 AGTCCCGCTGGCTGGCTGGGGGG - Intronic
1144662371 17:17079564-17079586 CCTCCCTGTGGCTGACTGACTGG + Intronic
1144774956 17:17780781-17780803 ATGCCCAGTGTCTAGCTGGCTGG + Intronic
1147189107 17:38728743-38728765 TCTCCACATGGCTGGCTGGCTGG + Exonic
1151480734 17:74368900-74368922 ACCCCCAGGGGCAGGATGGCAGG - Intronic
1151680700 17:75621269-75621291 ACTCTCCCTGCCTGGCTGGCTGG + Intergenic
1151963134 17:77417983-77418005 ACTCCCAGTGTCTGGCAGGTAGG - Intronic
1152124019 17:78435511-78435533 ACTCCCGTGTGCTGGCTGGCAGG + Intronic
1152218741 17:79049344-79049366 ACTCTCAGGAGCTGGGTGGCAGG + Exonic
1153070366 18:1098327-1098349 ACTGCCCGAGGCTGGCGGGCCGG - Intergenic
1157164338 18:45344381-45344403 AGTTCCGCTGGCTGGCTGGCTGG + Intronic
1159609567 18:70510779-70510801 ACTCCCACTGGCAGACTTGCTGG + Intergenic
1160911454 19:1475747-1475769 AGGCACAGTGGCTGGGTGGCAGG + Intronic
1161007291 19:1942906-1942928 ACTCCCGGGGGCTGCCTGCCTGG - Intronic
1161399067 19:4059598-4059620 ACTCCCAGGGGCTGGGGGCCAGG + Intronic
1162736806 19:12751597-12751619 CCTCCCAGTCGCTCACTGGCAGG - Intergenic
1163725384 19:18920482-18920504 ACTGCCAGTGAGTGGCAGGCTGG - Intronic
1163860072 19:19738170-19738192 ACCCCCAGGGGCTGGCCTGCGGG + Intergenic
1164596891 19:29536127-29536149 GCTCCCAGTGACTGGCTGCTGGG - Intronic
1164634801 19:29784615-29784637 ATTCCCAGTAGGTGGCTGGATGG + Intergenic
1165935278 19:39385087-39385109 TCTCCCAGTGCCGGGCTGGGTGG + Intronic
1167004672 19:46767716-46767738 AAAACCAGTGGCTGGGTGGCTGG - Intronic
1167331966 19:48861600-48861622 AGGGTCAGTGGCTGGCTGGCTGG - Exonic
1168351623 19:55679404-55679426 ACTCCCAGTGGCGGGATCTCAGG + Intronic
927910898 2:26898852-26898874 GCTCCCAGTGTATTGCTGGCAGG + Intronic
931220232 2:60282775-60282797 ACTTTGAGTGGCTGGCTTGCTGG - Intergenic
931443198 2:62305679-62305701 ACCCCCACTGCCTGGCTGGTTGG - Intergenic
931665427 2:64606934-64606956 TCTCCCATTGACTGGCTGGTGGG + Intergenic
932331042 2:70898603-70898625 ACTCCCAGGGCCTGGCCGGGAGG + Intergenic
932883209 2:75523576-75523598 AAGCCAAGTGGCTGGCAGGCTGG - Intronic
936058663 2:109280331-109280353 ACTGCCACTGGCTGGCTGTGGGG - Intronic
936881523 2:117257563-117257585 ATTCACAGTGGCTGACAGGCTGG + Intergenic
939398330 2:141660384-141660406 ATTCTCAGTGGCCGCCTGGCTGG + Intronic
941260140 2:163287491-163287513 ACTTCCAGACCCTGGCTGGCTGG + Intergenic
942051810 2:172147185-172147207 AGTGCCAGAGGCTGGCTGACAGG + Intergenic
943718752 2:191180691-191180713 CCTGCCGGTAGCTGGCTGGCAGG + Intergenic
946043280 2:216800663-216800685 CCTCCCAATGGCTGGAAGGCAGG - Intergenic
947520896 2:230845283-230845305 TCTCCCTGTGGCTGCCAGGCAGG + Intergenic
948147044 2:235715821-235715843 ACTCCCAGTGGCTGGAAGTCAGG - Intronic
948197413 2:236106104-236106126 GCTGCCCTTGGCTGGCTGGCTGG + Intronic
948351852 2:237347451-237347473 ACTCCCATTGCCTGGCCGTCTGG + Intronic
948596758 2:239084305-239084327 ACCCCGAGTGGCTCTCTGGCGGG - Intronic
1169116521 20:3069724-3069746 ACTCCCAGCAGCTGGGTGGCAGG + Intergenic
1170853419 20:20024737-20024759 TATGTCAGTGGCTGGCTGGCAGG + Intronic
1171161068 20:22924275-22924297 ACTCCCAAAAGTTGGCTGGCTGG + Intergenic
1172201806 20:33132135-33132157 ACTGCCTGGGGCTGGCTGGCTGG - Intergenic
1172765318 20:37347613-37347635 TCACCCAGCTGCTGGCTGGCAGG - Intronic
1173874924 20:46364317-46364339 ACTCCCAGAGGCTGGGGGGCCGG - Intronic
1174559663 20:51421634-51421656 ACTCCCAGTAGCTGCCATGCAGG + Intronic
1176090296 20:63315581-63315603 CGTCCCTGTGGCTGGCTGGGCGG + Intronic
1179176261 21:39010394-39010416 ACACCTAGAGGCTGGCTGTCAGG + Intergenic
1180071770 21:45440369-45440391 ACTCCCAGTGGACCCCTGGCAGG - Intronic
1180248108 21:46562057-46562079 ACTCCCGCTGGGTGGGTGGCAGG + Intronic
1181049002 22:20229936-20229958 TCTGCCAGTGGCTGCATGGCGGG + Intergenic
1181283479 22:21736014-21736036 ACTCCCATTGGCTGACCCGCCGG + Intergenic
1181450561 22:23017293-23017315 ACTCCCAGCGGCCCGCCGGCAGG - Intergenic
1181629566 22:24143469-24143491 GCTCCAACTGGCTGGCTAGCTGG + Intronic
1182114954 22:27751040-27751062 ACTGCAAGTGGCTGCCAGGCTGG + Exonic
1182570158 22:31231201-31231223 ACTACCAGTGTGTGGCAGGCAGG - Intronic
1183074598 22:35419038-35419060 ACTACCAGTGGGGGGCTGGTGGG + Intronic
1183272651 22:36871764-36871786 AGGCCCAGTGGCTGGCAGGTGGG - Intronic
1183932023 22:41240772-41240794 CCTCTCAGAGGCTGGCGGGCAGG - Intronic
1184129922 22:42511688-42511710 CCCACCTGTGGCTGGCTGGCTGG + Exonic
1184466698 22:44672730-44672752 ATGCACAGGGGCTGGCTGGCAGG - Intronic
950673521 3:14540931-14540953 ACTCCACGTGGCAGGCTGCCGGG - Intronic
951184959 3:19702656-19702678 ACTCGGAGCGGCCGGCTGGCCGG + Intergenic
952360456 3:32625727-32625749 ACTCTGAGTGGCTGGCCGGCCGG + Intergenic
953863485 3:46564616-46564638 ACTCCCACTGGGAGGCTGGGAGG + Intronic
953884136 3:46706065-46706087 ACTCCCCGTGGAGGGCTGACAGG + Intronic
953980967 3:47412861-47412883 ACTCTGGGAGGCTGGCTGGCGGG - Exonic
954130911 3:48560493-48560515 ACGCCCTGTGGCAGGCTGGAAGG - Intronic
954688412 3:52382982-52383004 ACTCACAGTGGCTGCCTTGAAGG - Intronic
954715775 3:52526046-52526068 ACTCCTAGTGACTGACAGGCAGG + Intronic
955392017 3:58528850-58528872 ACTCCAAGAGGCTGACTGCCAGG + Exonic
955898415 3:63725892-63725914 ACCCCCAGTGGCTTGCAGGTGGG - Intergenic
960991172 3:123312557-123312579 ATTCCCAGTGGCTGGCAGGAGGG - Intronic
961640570 3:128362221-128362243 ACTCACAGAGGCAGGCTGGATGG + Intronic
961795090 3:129403507-129403529 ACACCCAGTGGGCAGCTGGCAGG + Intronic
962173174 3:133124598-133124620 ACACTCAGGGGCTGGCTGGCTGG - Intronic
963666508 3:148194837-148194859 ACACCCAGGGGCTTGTTGGCGGG - Intergenic
964393797 3:156224199-156224221 ACTCAGAGCGGCCGGCTGGCTGG - Intronic
965193888 3:165568714-165568736 ACTGCCAGGGGCTGGCTGGTGGG + Intergenic
966594177 3:181711712-181711734 TTTCTCAGTGGCTGGCAGGCTGG + Intergenic
967983136 3:195077521-195077543 ACTCCAGGAGGCTGGCTGGGTGG - Intronic
968641770 4:1718414-1718436 CCTCCCACAGTCTGGCTGGCAGG - Exonic
968870448 4:3239396-3239418 ACCCCCAGATGCTGGCTGCCAGG + Intronic
969060452 4:4429824-4429846 ACTCCCAGTGGCTGGCTGGCAGG - Intronic
969882723 4:10188530-10188552 CCTCCCAGGGTCTGGCTGGCTGG + Intergenic
970933569 4:21541427-21541449 ACTCCCAGAGCCTGACTGCCTGG - Intronic
971279764 4:25233788-25233810 ACTCCCAGTGGAGGGCGGGAAGG - Intronic
973146305 4:46831141-46831163 ACTGCCCGGGGCTGGCAGGCCGG - Intronic
979896497 4:126164422-126164444 ACACCCAGTAACGGGCTGGCTGG + Intergenic
981015415 4:139969070-139969092 TCTCCCATTCACTGGCTGGCTGG - Intronic
981369601 4:143944794-143944816 TCTCCCAGAGCCTGCCTGGCAGG - Intergenic
981379340 4:144054738-144054760 ACTCCCAGAGCCTGCCTGGCAGG - Intergenic
984837165 4:184032836-184032858 ACTGCAAGTGGGTGGCTGTCAGG - Intergenic
987088595 5:14491130-14491152 ATTCCCAGTGGCTGGCTTGTTGG + Intronic
988090648 5:26536940-26536962 ACTCCCAGAGGCTAGCAGGTTGG - Intergenic
988146827 5:27319871-27319893 ACTGCTATTGGCTGGCTTGCTGG + Intergenic
988659231 5:33246571-33246593 CCTCCCAGTGGCAGGCTGGTTGG - Intergenic
989189997 5:38661290-38661312 AGTCCCAGTGGATGGATGGGTGG + Intergenic
991452747 5:66770397-66770419 CCTCCCAGTGGCTCTCTGTCAGG + Intronic
991550088 5:67826171-67826193 AACCCCAGGGGATGGCTGGCTGG + Intergenic
993626362 5:90229469-90229491 ACTGGCAGTGGTTGGATGGCAGG - Intergenic
995104962 5:108366547-108366569 ACTACCAGTAGCGGGCTGGGTGG + Intronic
995981066 5:118104910-118104932 ACTTCCAGTGTTTGCCTGGCTGG - Intergenic
996346469 5:122493467-122493489 GCACCCCGTGGCTGGCTGGCTGG + Intergenic
998232117 5:140367425-140367447 ACTCCCTGGGCGTGGCTGGCTGG + Exonic
1000103792 5:158039651-158039673 ACCCCCAGTGGCTTTCTAGCTGG - Intergenic
1000908214 5:166989189-166989211 CCTCCCAGTGGATGGGTGGATGG + Intergenic
1001264424 5:170262583-170262605 ACTCACAGTGGCCGGCAGACAGG - Intronic
1002468868 5:179422818-179422840 GCTCCCAGTGCCTGGCAGGGAGG - Intergenic
1003304287 6:4912458-4912480 ACTTACAGTTGCTGACTGGCAGG + Intronic
1004234252 6:13860222-13860244 ACTCGGAGTGGCTGGCTGGCCGG + Intergenic
1005440460 6:25861929-25861951 GCTCCCAGTGGATACCTGGCTGG - Exonic
1005634260 6:27738500-27738522 ACAGCCATTGACTGGCTGGCTGG - Intergenic
1007947185 6:45837200-45837222 ACTCTCAGTGTCTAGCTGGCAGG + Intergenic
1009800714 6:68533536-68533558 ACTGCCAGGGGCTTGCGGGCCGG - Intergenic
1012510260 6:99993805-99993827 CCTCCCCGGGGCTGGCTCGCCGG - Intronic
1014273849 6:119365013-119365035 AGTGGAAGTGGCTGGCTGGCAGG - Intergenic
1014738985 6:125125941-125125963 ACTCGGAGTGGCCGGCCGGCGGG + Intronic
1015300103 6:131643394-131643416 ACACCCATTGGCTGGCTTCCCGG + Intronic
1015863554 6:137705214-137705236 TCTTTCAGTGGCTGGCTGGCAGG - Intergenic
1017887412 6:158610518-158610540 GCTCCCAGTGGCTCTTTGGCAGG + Intronic
1019166266 6:170099545-170099567 ACTGCCCTTGGCTGGCTGGTCGG + Intergenic
1019933942 7:4242176-4242198 ACACCCAGGGGCTGCCAGGCTGG + Intronic
1021567376 7:22028767-22028789 ACTCGGAGCGGCTGGCCGGCCGG + Intergenic
1021724926 7:23539331-23539353 AATGCCAGTGGCTTGCTGGGAGG - Intergenic
1021798779 7:24284259-24284281 ACTCACGGTGGCTGGCGCGCGGG - Exonic
1022484264 7:30765804-30765826 CCTCCCAGGGACTGGCTGTCAGG - Intronic
1022590161 7:31653923-31653945 ACTCCCACTGGCTGCCTGACTGG - Intronic
1022957303 7:35392928-35392950 ACCCCCAGTGGCTGATTGCCAGG - Intergenic
1026948975 7:74334654-74334676 ACGCACAGTGGGTGCCTGGCAGG - Intronic
1027650382 7:80859791-80859813 CAGCTCAGTGGCTGGCTGGCTGG + Intronic
1029191075 7:98772703-98772725 TCTCCCAGTGCCTGGGTGGTGGG - Intergenic
1029276607 7:99408804-99408826 ACTTCCGGTGGGTGGCAGGCAGG - Exonic
1029443213 7:100599693-100599715 TCTCCCCGAGGCTGGCAGGCAGG + Intronic
1029471620 7:100758368-100758390 ACTCCAACTGGCTGGCAGGCAGG - Intronic
1030336643 7:108335474-108335496 AAGACAAGTGGCTGGCTGGCTGG + Intronic
1030386685 7:108875082-108875104 ACCTCGTGTGGCTGGCTGGCTGG + Intergenic
1031029264 7:116716831-116716853 TCAGCCCGTGGCTGGCTGGCCGG + Intronic
1032732031 7:134652986-134653008 ATACCCAGTGGCGGGCTTGCTGG + Intronic
1033781219 7:144671607-144671629 ACACCCAGTGGCCGGCTCACAGG + Intronic
1034192210 7:149221468-149221490 ACTCCCAGGGGCTGTCTCCCGGG - Intronic
1034958738 7:155351289-155351311 GCTGCCAGTGGCTCCCTGGCTGG - Intergenic
1035240290 7:157524522-157524544 GCTCCCAGTGGCTGGCAGCTGGG - Intergenic
1035416478 7:158693362-158693384 AAGCCCAGTGGATGGGTGGCAGG - Exonic
1035574768 8:697492-697514 ACTCCCAGTGACAGGCCTGCAGG + Intronic
1036133168 8:6135144-6135166 ACACCCAGCGCCTGGCTGGTAGG - Intergenic
1036808110 8:11848902-11848924 ACTCCGAGAGTCTGGCAGGCAGG - Intronic
1042616541 8:70655709-70655731 ACACCCAGTAGCTGGATTGCTGG + Intronic
1046986851 8:120397782-120397804 ACTCCCTGGAGCTGGCAGGCTGG - Intronic
1049466448 8:142753120-142753142 ACACCCTGTAGCTGGCTGTCCGG - Intergenic
1049780984 8:144428746-144428768 CCTCCCCGTGGCTGCCTGGCAGG - Intergenic
1052246865 9:26346948-26346970 TCTCACAGTGGATGGCAGGCAGG - Intergenic
1053319908 9:37087718-37087740 AGTCCCACTGGATGCCTGGCAGG - Intergenic
1055303860 9:74908868-74908890 ACTCTCATTGGCTGCTTGGCAGG - Intergenic
1057272771 9:93660088-93660110 ACACTCAGTGCCAGGCTGGCGGG - Intronic
1057748504 9:97771441-97771463 ACACCCAGTGCCTGGCTCACAGG - Intergenic
1057857117 9:98610179-98610201 ACTCCCAGTTGGTGGCTTCCTGG + Intronic
1061597687 9:131642756-131642778 ACTGCCAGGGGCTGGATTGCAGG - Intronic
1061797824 9:133098558-133098580 CCTCCCAGGGTCTGGCTGGCTGG - Exonic
1061940568 9:133881611-133881633 GTTTCCAGTGGCTGGCTGCCAGG - Intronic
1062080282 9:134620083-134620105 CCTCCCAGTGGCCAGCTGGCCGG - Intergenic
1062099476 9:134720734-134720756 GCTCCCAGGGGCTGGTTGCCTGG + Intronic
1062554364 9:137107303-137107325 GCTCCATGTGGCTGGCGGGCAGG - Exonic
1185655714 X:1683671-1683693 ACCCCCACTGGCTGCCTGACAGG - Intergenic
1186293177 X:8121691-8121713 ACTGCCAGGGGCTTGCGGGCCGG - Intergenic
1187204706 X:17171002-17171024 ACTCCATCTGTCTGGCTGGCAGG + Intergenic
1187943963 X:24408614-24408636 ACACCCAGTTGCTGGCTGAAGGG - Intergenic
1189620857 X:42835754-42835776 ACTCCAAGTGGTTGGTTGCCAGG - Intergenic
1190491325 X:50985259-50985281 ACTGCTAGTGGCTGGAGGGCAGG + Intergenic
1190756296 X:53404892-53404914 ACTCCCTGCGGCAGGCTGGGAGG + Intronic
1192202032 X:69072586-69072608 ACACACAAAGGCTGGCTGGCTGG + Intergenic
1193081872 X:77414217-77414239 ACTCTGGCTGGCTGGCTGGCTGG - Intergenic
1195003220 X:100662413-100662435 ACCCTCAGCAGCTGGCTGGCTGG - Intronic
1196705928 X:118717194-118717216 ACTGCCCGGGGCCGGCTGGCCGG + Intergenic
1199169353 X:144717895-144717917 GTGCCCAGTGGCAGGCTGGCTGG + Intergenic
1199688892 X:150291128-150291150 AAGCACAGTTGCTGGCTGGCAGG - Intergenic
1200214073 X:154359696-154359718 ACTCCCACAGGCTGGCAGACGGG - Intronic