ID: 969065941

View in Genome Browser
Species Human (GRCh38)
Location 4:4481095-4481117
Sequence AATTCACAAAACACCCACGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969065941_969065944 14 Left 969065941 4:4481095-4481117 CCTTCGTGGGTGTTTTGTGAATT 0: 1
1: 0
2: 0
3: 18
4: 103
Right 969065944 4:4481132-4481154 ATACTGTACAACAAAAACCCTGG No data
969065941_969065946 28 Left 969065941 4:4481095-4481117 CCTTCGTGGGTGTTTTGTGAATT 0: 1
1: 0
2: 0
3: 18
4: 103
Right 969065946 4:4481146-4481168 AAACCCTGGTACAAAATGATGGG 0: 1
1: 0
2: 0
3: 14
4: 165
969065941_969065945 27 Left 969065941 4:4481095-4481117 CCTTCGTGGGTGTTTTGTGAATT 0: 1
1: 0
2: 0
3: 18
4: 103
Right 969065945 4:4481145-4481167 AAAACCCTGGTACAAAATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969065941 Original CRISPR AATTCACAAAACACCCACGA AGG (reversed) Intronic