ID: 969065942

View in Genome Browser
Species Human (GRCh38)
Location 4:4481119-4481141
Sequence TGTACAGTATATCGTGCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 73}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969065942_969065944 -10 Left 969065942 4:4481119-4481141 CCCAAAGCACGATATACTGTACA 0: 1
1: 0
2: 0
3: 3
4: 73
Right 969065944 4:4481132-4481154 ATACTGTACAACAAAAACCCTGG No data
969065942_969065946 4 Left 969065942 4:4481119-4481141 CCCAAAGCACGATATACTGTACA 0: 1
1: 0
2: 0
3: 3
4: 73
Right 969065946 4:4481146-4481168 AAACCCTGGTACAAAATGATGGG 0: 1
1: 0
2: 0
3: 14
4: 165
969065942_969065945 3 Left 969065942 4:4481119-4481141 CCCAAAGCACGATATACTGTACA 0: 1
1: 0
2: 0
3: 3
4: 73
Right 969065945 4:4481145-4481167 AAAACCCTGGTACAAAATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969065942 Original CRISPR TGTACAGTATATCGTGCTTT GGG (reversed) Intronic