ID: 969065943 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:4481120-4481142 |
Sequence | TTGTACAGTATATCGTGCTT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
969065943_969065945 | 2 | Left | 969065943 | 4:4481120-4481142 | CCAAAGCACGATATACTGTACAA | No data | ||
Right | 969065945 | 4:4481145-4481167 | AAAACCCTGGTACAAAATGATGG | No data | ||||
969065943_969065946 | 3 | Left | 969065943 | 4:4481120-4481142 | CCAAAGCACGATATACTGTACAA | No data | ||
Right | 969065946 | 4:4481146-4481168 | AAACCCTGGTACAAAATGATGGG | 0: 1 1: 0 2: 0 3: 14 4: 165 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
969065943 | Original CRISPR | TTGTACAGTATATCGTGCTT TGG (reversed) | Intronic | ||