ID: 969065944

View in Genome Browser
Species Human (GRCh38)
Location 4:4481132-4481154
Sequence ATACTGTACAACAAAAACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969065938_969065944 28 Left 969065938 4:4481081-4481103 CCTTGCTAGCTGTTCCTTCGTGG 0: 1
1: 0
2: 1
3: 6
4: 93
Right 969065944 4:4481132-4481154 ATACTGTACAACAAAAACCCTGG No data
969065942_969065944 -10 Left 969065942 4:4481119-4481141 CCCAAAGCACGATATACTGTACA 0: 1
1: 0
2: 0
3: 3
4: 73
Right 969065944 4:4481132-4481154 ATACTGTACAACAAAAACCCTGG No data
969065941_969065944 14 Left 969065941 4:4481095-4481117 CCTTCGTGGGTGTTTTGTGAATT 0: 1
1: 0
2: 0
3: 18
4: 103
Right 969065944 4:4481132-4481154 ATACTGTACAACAAAAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969065944 Original CRISPR ATACTGTACAACAAAAACCC TGG Intronic