ID: 969065945

View in Genome Browser
Species Human (GRCh38)
Location 4:4481145-4481167
Sequence AAAACCCTGGTACAAAATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969065941_969065945 27 Left 969065941 4:4481095-4481117 CCTTCGTGGGTGTTTTGTGAATT 0: 1
1: 0
2: 0
3: 18
4: 103
Right 969065945 4:4481145-4481167 AAAACCCTGGTACAAAATGATGG No data
969065943_969065945 2 Left 969065943 4:4481120-4481142 CCAAAGCACGATATACTGTACAA No data
Right 969065945 4:4481145-4481167 AAAACCCTGGTACAAAATGATGG No data
969065942_969065945 3 Left 969065942 4:4481119-4481141 CCCAAAGCACGATATACTGTACA 0: 1
1: 0
2: 0
3: 3
4: 73
Right 969065945 4:4481145-4481167 AAAACCCTGGTACAAAATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969065945 Original CRISPR AAAACCCTGGTACAAAATGA TGG Intronic