ID: 969065946

View in Genome Browser
Species Human (GRCh38)
Location 4:4481146-4481168
Sequence AAACCCTGGTACAAAATGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969065943_969065946 3 Left 969065943 4:4481120-4481142 CCAAAGCACGATATACTGTACAA No data
Right 969065946 4:4481146-4481168 AAACCCTGGTACAAAATGATGGG 0: 1
1: 0
2: 0
3: 14
4: 165
969065942_969065946 4 Left 969065942 4:4481119-4481141 CCCAAAGCACGATATACTGTACA 0: 1
1: 0
2: 0
3: 3
4: 73
Right 969065946 4:4481146-4481168 AAACCCTGGTACAAAATGATGGG 0: 1
1: 0
2: 0
3: 14
4: 165
969065941_969065946 28 Left 969065941 4:4481095-4481117 CCTTCGTGGGTGTTTTGTGAATT 0: 1
1: 0
2: 0
3: 18
4: 103
Right 969065946 4:4481146-4481168 AAACCCTGGTACAAAATGATGGG 0: 1
1: 0
2: 0
3: 14
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969065946 Original CRISPR AAACCCTGGTACAAAATGAT GGG Intronic