ID: 969066122

View in Genome Browser
Species Human (GRCh38)
Location 4:4482693-4482715
Sequence CATTCTGGGCAGAGAGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 445}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969066122_969066128 24 Left 969066122 4:4482693-4482715 CCTGCTTCTCTCTGCCCAGAATG 0: 1
1: 0
2: 2
3: 51
4: 445
Right 969066128 4:4482740-4482762 TACTCAAAATTGCAGGCCCAAGG No data
969066122_969066127 17 Left 969066122 4:4482693-4482715 CCTGCTTCTCTCTGCCCAGAATG 0: 1
1: 0
2: 2
3: 51
4: 445
Right 969066127 4:4482733-4482755 CAACTTCTACTCAAAATTGCAGG No data
969066122_969066129 27 Left 969066122 4:4482693-4482715 CCTGCTTCTCTCTGCCCAGAATG 0: 1
1: 0
2: 2
3: 51
4: 445
Right 969066129 4:4482743-4482765 TCAAAATTGCAGGCCCAAGGAGG 0: 1
1: 0
2: 1
3: 8
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969066122 Original CRISPR CATTCTGGGCAGAGAGAAGC AGG (reversed) Intronic
900195615 1:1374237-1374259 CAGTCTGGGCAGGAAGCAGCGGG + Exonic
900479584 1:2891624-2891646 CACTCAGGGATGAGAGAAGCTGG + Intergenic
900546735 1:3233595-3233617 CCTGCTGGGCAGAGAGGACCAGG - Intronic
901557898 1:10046089-10046111 CATTCTGGCCAGAGAGGGGAGGG + Intronic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902355712 1:15898057-15898079 CATTGTGGGCAAAAAGCAGCAGG + Intronic
902482014 1:16717063-16717085 CATTCAGGGCAGAGTGAGGAGGG - Intergenic
902659244 1:17889976-17889998 CCTTCTGGGCAGAAAGAAGTGGG + Intergenic
904026099 1:27504693-27504715 CATTCTCACCAGAGGGAAGCAGG - Intergenic
904163632 1:28538722-28538744 CACTCTGGGCAGAGCAGAGCAGG + Intronic
904291663 1:29490112-29490134 CATTCCGGACAGAGGAAAGCTGG + Intergenic
904378600 1:30096621-30096643 CATCATGGTCAGAGGGAAGCAGG + Intergenic
904480614 1:30791113-30791135 CATTGCAGCCAGAGAGAAGCAGG - Intergenic
904494584 1:30879480-30879502 CTTTCTGGGCAGAGGGGAGCTGG - Intronic
904743289 1:32695113-32695135 CAAACTGGGCAGAGAGTCGCCGG + Exonic
905033455 1:34902667-34902689 CATTCTCTACAGAGAGCAGCAGG + Intronic
905267198 1:36762822-36762844 CATTCTAGGCAGAGGGAACAGGG + Intergenic
905811294 1:40915357-40915379 CTTCCTGGGCAGAGTGATGCAGG + Intergenic
905839551 1:41163021-41163043 CAGTTTGGGCAAAGAGAAGGAGG + Intronic
908065023 1:60393481-60393503 CATTCTAGGCAGTGAGAAATGGG - Intergenic
908413951 1:63894199-63894221 CATTCTGGGCAGGATGGAGCAGG + Intronic
908433006 1:64077468-64077490 GTGTCTGGGAAGAGAGAAGCAGG + Intronic
909344242 1:74566924-74566946 GATTCTTGGGACAGAGAAGCCGG - Intergenic
909900865 1:81133053-81133075 CATTCTTGAAAGAGAGAAGAAGG - Intergenic
910430428 1:87154655-87154677 CAGTCTGGGCAGAGGGGAGTGGG - Intronic
910522534 1:88138949-88138971 CATGCTGGGGAGAGAAAAGGTGG + Intergenic
913523237 1:119666076-119666098 TATACTGGCCAGAGAGAAGAGGG + Intronic
913962837 1:143353188-143353210 CATTCTGGACGCAGAGGAGCTGG - Intergenic
914057192 1:144178773-144178795 CATTCTGGACGCAGAGGAGCTGG - Intergenic
914121954 1:144787593-144787615 CATTCTGGACGCAGAGGAGCTGG + Intergenic
914224364 1:145707867-145707889 AATCCAGGGCAGAGGGAAGCAGG - Intronic
915357167 1:155262254-155262276 CAATCCGTGCACAGAGAAGCGGG - Exonic
915590338 1:156866845-156866867 CATTCTGGTCAGAGTGAGGTCGG + Intronic
917754612 1:178086790-178086812 CATTCTCGGTAGAAAGAAGTTGG - Intergenic
917859450 1:179132361-179132383 CGATCTGGGCTGTGAGAAGCAGG - Intronic
918526893 1:185474407-185474429 CATTGTGGGGAGAGAAAAACAGG - Intergenic
919350136 1:196440996-196441018 CATCCTGCTCAGAAAGAAGCTGG + Intronic
919608986 1:199721765-199721787 CATTCTGGGAAGCGTGGAGCAGG - Intergenic
920250065 1:204617557-204617579 GCCTCTGGGCAGAGAGAAGATGG + Exonic
920678967 1:208058506-208058528 CATCCCGGGCAGTGAGCAGCAGG - Intronic
920983485 1:210861710-210861732 CAGACTGGTCAGAAAGAAGCTGG + Intronic
922175030 1:223190058-223190080 CGTCCTGGGCAGAGAGAGGTGGG - Intergenic
922449274 1:225723701-225723723 CTTTCTGTGCAGCGAGAAGCAGG + Intergenic
922606620 1:226893768-226893790 CAACCTGGGCAGAGAAAAGCGGG - Intronic
922905396 1:229170092-229170114 CATTCTGAGCAGAGTCAAACAGG - Intergenic
923782259 1:237035656-237035678 CACTATGGGCAGAGCGAAGGAGG - Intergenic
1062785703 10:263041-263063 CTTTGTGGGCAGAAAGCAGCAGG - Intergenic
1062898733 10:1125690-1125712 CATTGTGGCCAGGCAGAAGCTGG + Intronic
1062956865 10:1546288-1546310 CTTTCCGTGCAGAGAGCAGCAGG + Intronic
1063759163 10:9052732-9052754 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1064918267 10:20486679-20486701 CTTACTGGCCAGAGAGAAGAGGG + Intergenic
1065835782 10:29656829-29656851 CTTTCTGTGCAGTGAGCAGCAGG + Intronic
1067792693 10:49299798-49299820 CATTCAGGGCTGAGGGAGGCTGG + Intronic
1068700641 10:60016003-60016025 CTTTCTGTGCAGCGAGCAGCAGG + Intergenic
1069900798 10:71705585-71705607 CACCCTGGGAAGAGAGCAGCTGG + Intronic
1071056221 10:81510840-81510862 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
1071073525 10:81724781-81724803 CTTTCTGTGCAGAGAGCTGCAGG + Intergenic
1071208350 10:83310273-83310295 CATTCTAGGCAGAGAGAGCTGGG - Intergenic
1072208695 10:93226560-93226582 AATTCTAGGCAGACAGAGGCAGG - Intergenic
1072278987 10:93848935-93848957 CATTCTGTGCAGTGAGCAGCAGG + Intergenic
1072608420 10:97001727-97001749 AAGGCTGGGCAGGGAGAAGCTGG - Intronic
1072766461 10:98098519-98098541 GATGCTGGGGACAGAGAAGCTGG - Intergenic
1073328393 10:102655967-102655989 CATTCTGGACAGAAAGTGGCAGG - Intronic
1073373910 10:103016428-103016450 CATTCTAGGCACAGAGGAGACGG + Intronic
1073951138 10:108811325-108811347 AAGTCAGGGAAGAGAGAAGCTGG + Intergenic
1074536850 10:114334228-114334250 CTGCCTGGGCAGAGAAAAGCTGG + Intronic
1074563777 10:114558106-114558128 CTTTCTGTGCAGCGAGCAGCGGG + Intronic
1075307892 10:121384078-121384100 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1075960151 10:126561709-126561731 CATTCCAAGCAGAGAGAATCAGG + Intronic
1076235502 10:128861073-128861095 TATTTTGGGAAGAAAGAAGCAGG - Intergenic
1076287907 10:129319070-129319092 CTTTCTGTGCTGAGAGCAGCAGG - Intergenic
1077269602 11:1669328-1669350 CTTTCTGTGCAGAGAGCAGGGGG + Intergenic
1078228309 11:9414333-9414355 CAGACTGGTCAGAAAGAAGCTGG - Exonic
1078663613 11:13306606-13306628 CATTCTGGGCAGAGGAATTCTGG + Intronic
1079078074 11:17395927-17395949 CGATCTGGAAAGAGAGAAGCAGG + Exonic
1079134713 11:17769997-17770019 CATTCTGTGTTGAGGGAAGCTGG - Intronic
1079459577 11:20668620-20668642 CATTCTCTGGAGAGAAAAGCTGG - Intergenic
1080115528 11:28617577-28617599 CATTGTAGGAAGAGAGAAGCAGG - Intergenic
1081038124 11:38176311-38176333 AACTCTAGGCAGACAGAAGCGGG + Intergenic
1081152811 11:39652697-39652719 GATTCTGGGCAGACAGCGGCGGG - Intergenic
1081964994 11:47164159-47164181 CTTTCAGAGAAGAGAGAAGCAGG + Intronic
1082657053 11:55868998-55869020 CCTTCTGAGCAAAGAGAAGGGGG + Intergenic
1083202884 11:61131081-61131103 CCCTCTGGCCAGAGGGAAGCGGG - Exonic
1083770485 11:64864289-64864311 CCTTCTGGGCACAGGGAACCTGG - Intronic
1083771790 11:64871678-64871700 CATTATGGGCAGGAAGGAGCCGG - Intronic
1083843492 11:65317412-65317434 CATTCTGGGCAGGGTGAGGGTGG - Intronic
1083869415 11:65477672-65477694 GATCCTGGGGAGGGAGAAGCAGG - Intergenic
1084043251 11:66554869-66554891 CATTCCAGCCAGAGGGAAGCTGG + Intronic
1084481085 11:69420633-69420655 GATTCTGGGCAGGGTGAAGCCGG + Intergenic
1084659696 11:70539635-70539657 GAGTCTGGGCAGGGAGAAGCTGG - Intronic
1085153004 11:74267226-74267248 AACTGTTGGCAGAGAGAAGCTGG - Exonic
1086745142 11:90416190-90416212 AATTCTGGGAACAGATAAGCTGG - Intergenic
1088986413 11:114913267-114913289 ATTTGTGGGCAGAGAGAGGCAGG + Intergenic
1089021050 11:115215362-115215384 CATTCTGGGTAGGGGGATGCAGG - Intronic
1090481431 11:127072067-127072089 TCTCCTGGGGAGAGAGAAGCAGG - Intergenic
1091221995 11:133935281-133935303 GATTCTGGGCACAGAGGTGCAGG + Intronic
1091255051 11:134176383-134176405 CCTCCTGTGCAGAGAGAAGCCGG + Exonic
1091608122 12:1975553-1975575 AATTCTTGGCAGAGAAAAGCTGG - Intronic
1091706125 12:2694669-2694691 CATGCTGGGTGGAGAAAAGCTGG - Intronic
1094046106 12:26168641-26168663 CATTCTGGGCAGCAGGAAGAAGG + Intronic
1095785167 12:46101851-46101873 CGTGCTGGGTAGAGAAAAGCGGG + Intergenic
1095790110 12:46157575-46157597 CATTCTGGGGCTGGAGAAGCAGG - Intergenic
1095874695 12:47067959-47067981 CATGCTGAGTACAGAGAAGCAGG - Intergenic
1095970257 12:47896902-47896924 CAATCTGGCCAGGGAGATGCTGG - Intronic
1097144298 12:56929468-56929490 CATTCTCGGCAAGGAGAACCTGG - Exonic
1097853532 12:64437449-64437471 CATTCTGGGCAAAGTTAAGTAGG + Intronic
1098140094 12:67442470-67442492 CATTTTGGGGAGAGGGCAGCGGG + Intergenic
1098437470 12:70483240-70483262 CATTCTGTGCAGTGAGCAGCAGG - Intergenic
1098574730 12:72028320-72028342 CACTCTGGACATAGAGAAGAGGG + Intronic
1099517486 12:83615394-83615416 CTTTCTGTACAGAGAGCAGCAGG + Intergenic
1099730012 12:86488905-86488927 AATTCTGGGCAGACAGAGGTGGG + Intronic
1100857208 12:98768059-98768081 CCTTCTGGGCAGTGAGAACTTGG - Intronic
1100898575 12:99213226-99213248 TGCTCTGGGTAGAGAGAAGCAGG - Intronic
1101202399 12:102450416-102450438 CATTCGTGGCAGAGAGCTGCTGG - Intronic
1101291744 12:103377506-103377528 CATTCTGGGTAGAGAGCAGGAGG + Intronic
1101407676 12:104443065-104443087 CATTCTTGTAAGAGGGAAGCAGG + Intergenic
1101440515 12:104701227-104701249 CATTCTGGGCAGAAAGACATGGG - Intronic
1101537746 12:105634908-105634930 CATTCTGGGCAGAAAGTGGCAGG + Intergenic
1101709073 12:107248151-107248173 GATTCTGGGCAGAGGTTAGCTGG - Intergenic
1101954066 12:109198216-109198238 CATTCTTGGCAGATAGAACGTGG - Intronic
1104015733 12:124960485-124960507 CAGCCTGGGCAGACAGAAACCGG + Intronic
1104060573 12:125264499-125264521 CATTCTGGGCAGATAGGGCCTGG + Intronic
1104391045 12:128390762-128390784 CAGCCTGGGAAGAGCGAAGCCGG + Intronic
1105662676 13:22515937-22515959 GATTCTGGGGATAGAGAAGGGGG - Intergenic
1105882143 13:24614532-24614554 CCTCCTGGACAGAGAGAGGCAGG + Intergenic
1106629109 13:31452077-31452099 AATTCTAGGCAGACAGAAGTGGG + Intergenic
1107463874 13:40631113-40631135 CATTCAGGGCCAAGAGAGGCTGG + Intronic
1109522129 13:63527452-63527474 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1109883949 13:68518075-68518097 GATTCTGGGCATACACAAGCAGG + Intergenic
1110537376 13:76667145-76667167 CTTTCTGTGCAGCGAGCAGCAGG - Intergenic
1111201909 13:84949071-84949093 CTTTCTTTGCAGAGAGCAGCAGG + Intergenic
1111558628 13:89913819-89913841 CTTTCTGTGCTGAGAGCAGCGGG + Intergenic
1112430504 13:99346568-99346590 CATTCTGGGCAGAGAGGAAAGGG - Intronic
1114059982 14:19009600-19009622 CATGCTGGGCAAGGACAAGCTGG - Intergenic
1114908641 14:27164012-27164034 CTTTCAGGGAAGAGAGGAGCTGG - Intergenic
1117221265 14:53608883-53608905 CCATCTGGGCAGAGAAAGGCTGG - Intergenic
1118971890 14:70643755-70643777 CATTCTGGGAAGACAGAGGTAGG - Intronic
1119001309 14:70884482-70884504 CATTCCTGGCAGAGAAGAGCAGG + Intergenic
1119409656 14:74422461-74422483 TACACTGGGCAGACAGAAGCAGG - Intronic
1119659755 14:76441868-76441890 CATTCTGGGGACAGTGAGGCAGG - Intronic
1119683096 14:76607433-76607455 GATTGTTGGCAGAGAGGAGCAGG - Intergenic
1121359527 14:93243922-93243944 CATTCTGGGGTGGGGGAAGCAGG + Intronic
1121742474 14:96263954-96263976 CCTTCTGGGCAGAGAATATCTGG + Exonic
1121876849 14:97460680-97460702 CCTTCAGGGCAGAGAGAAGATGG + Intergenic
1122136866 14:99638463-99638485 CAGTCTGGCCAGAGAGGCGCTGG + Intergenic
1202849536 14_GL000225v1_random:8335-8357 CGGTATGGGCAGAGAGAGGCCGG - Intergenic
1123552611 15:21397710-21397732 CATGCTGGGCAAGGACAAGCTGG + Intergenic
1123588857 15:21835098-21835120 CATGCTGGGCAAGGACAAGCTGG + Intergenic
1124069278 15:26376490-26376512 CTTTCTGTGCAGTGAGCAGCTGG - Intergenic
1125102311 15:35928629-35928651 CAGTCTCTGCAGTGAGAAGCAGG + Intergenic
1125470513 15:39997905-39997927 CTTACTGAGCAGAGTGAAGCAGG + Intronic
1125883605 15:43212784-43212806 CATTCTGGGAAGCTAGAAGCAGG + Intronic
1128894645 15:71361255-71361277 GAATCTGGGCACAGAGAAGTAGG - Intronic
1129256696 15:74337861-74337883 CAGGCTGGGCAGAAAGGAGCAGG + Exonic
1129272846 15:74428578-74428600 CTTTCTGGGCAGAAAGGAGGAGG + Intronic
1130226649 15:82064051-82064073 CCCTCTGGGCAGAGATATGCAGG - Intergenic
1130361950 15:83197432-83197454 CAATCTGAGTAGAGAGAACCTGG - Intronic
1130915467 15:88301152-88301174 CATTCCGCTCAGGGAGAAGCTGG - Intergenic
1130918693 15:88325944-88325966 CATCCTGTGCAGAAAGAATCAGG - Intergenic
1131532158 15:93203031-93203053 CCTCTTGGGCAGAGAGAAGAAGG - Intergenic
1132211540 15:100027055-100027077 CATTATGGGCAGGGAGAACAGGG + Intronic
1132392247 15:101447487-101447509 CATTCTGCTCACAGACAAGCAGG + Intronic
1202960960 15_KI270727v1_random:124930-124952 CATGCTGGGCAAGGACAAGCTGG + Intergenic
1133537487 16:6715917-6715939 CATACTAGGAAGAGAGAAGCAGG - Intronic
1134058072 16:11182593-11182615 CAGGCTGGGCCGAGGGAAGCAGG + Intergenic
1134596092 16:15497121-15497143 CCTTCTGTGCAGTGAGCAGCAGG - Intronic
1134597394 16:15506871-15506893 CTTTCTGTGCAGCGAGTAGCAGG + Intronic
1135921333 16:26651380-26651402 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1135927123 16:26705287-26705309 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1136297900 16:29314094-29314116 CAGCCTGGACAGAGAGGAGCGGG + Intergenic
1137043939 16:35639155-35639177 GACTCTGGGCAGAGAGAAGGAGG + Intergenic
1137602836 16:49768312-49768334 CATTCTGGGCCGAGAAGAGTTGG - Intronic
1137815624 16:51395245-51395267 AATTCTGGGCAGACAGGGGCAGG + Intergenic
1138359865 16:56418941-56418963 CATTTCTGGAAGAGAGAAGCAGG + Intronic
1139284168 16:65796029-65796051 CAATAAGGGCAGAGAGAAGCAGG - Intergenic
1140029831 16:71326788-71326810 CATTCTGGGCAGAAATTACCAGG - Intergenic
1141146331 16:81532841-81532863 CTGTCTGGGCAGAGAGGCGCAGG - Intronic
1141884424 16:86881995-86882017 TCTGCTGTGCAGAGAGAAGCTGG - Intergenic
1141961612 16:87412866-87412888 CATTCTGCACAGGGAGAACCTGG + Exonic
1141987665 16:87590360-87590382 AATTCTGTGCAGAGAGGAGGGGG + Intergenic
1142181345 16:88672366-88672388 CATGCTGGGCAGAGCCCAGCTGG + Intergenic
1142192838 16:88725778-88725800 CAGCGTGGGCAGAGAGGAGCAGG - Intronic
1142413023 16:89925828-89925850 CACTCTGGGCAGAGGGAAGTCGG + Intronic
1143022112 17:3922126-3922148 AATCCAGGGCAGAGAGAGGCCGG - Intergenic
1143026374 17:3944101-3944123 CATTCAGGCCAGAGAGATGCGGG - Intronic
1143253516 17:5539375-5539397 CCTTCTGGGCAGAGGGAAGAGGG - Intronic
1143918610 17:10313168-10313190 CATTCAGCGCACAGAGGAGCTGG - Exonic
1144453319 17:15399091-15399113 CATTCAGGGGAGAGAGAACATGG - Intergenic
1144540873 17:16141129-16141151 GAATCTGGGCACAGTGAAGCTGG + Intronic
1145183454 17:20773352-20773374 CTTTCTGTGCAGAGAGCAGCAGG + Intergenic
1146745489 17:35324929-35324951 CTTTCTGTGCAGGGAGCAGCAGG + Intergenic
1147241043 17:39090703-39090725 CAGTCGGGGCAGAGAGAAAAGGG - Intronic
1147452614 17:40515190-40515212 CCTTCTCTGCAGACAGAAGCAGG + Intergenic
1147677935 17:42220142-42220164 CATGCTGGGCCGCGAGAAGAGGG - Intronic
1148569390 17:48656131-48656153 CATTCTGGGCAGAGCACAACAGG + Intergenic
1149018532 17:51936516-51936538 CAGTCTTGGCAGAGAAGAGCTGG + Intronic
1151209243 17:72531856-72531878 CATTCTGGCCGGGGAGAAGAGGG + Intergenic
1151350519 17:73529148-73529170 GATTCTGGGAAGAGAGGAGGTGG + Intronic
1151887751 17:76933130-76933152 GATTAGAGGCAGAGAGAAGCAGG + Intronic
1154453524 18:14501107-14501129 CATGCTGGGCAAGGACAAGCTGG + Intergenic
1155112477 18:22729677-22729699 TATTCTAGGCAGAAAGAAGGAGG - Intergenic
1155614110 18:27701578-27701600 CGTTCTAGGCAGAGAGAAAGTGG + Intergenic
1155840268 18:30633964-30633986 AATTCTAGGCAGACAGAGGCAGG - Intergenic
1156399527 18:36728020-36728042 CATTCTAGGCAGGAAGAAGGGGG + Intronic
1157409497 18:47451942-47451964 CTTACAGGGCAGGGAGAAGCTGG + Intergenic
1157559695 18:48637631-48637653 TATTCTGTCCCGAGAGAAGCTGG + Intronic
1157934714 18:51860040-51860062 CACGCTGGGCAGAAAGAAGTGGG - Intergenic
1158365501 18:56730202-56730224 CATTCTGGGTGGAGAGAGGCAGG + Intronic
1158483795 18:57846509-57846531 CATTCAGAGCAGAGAGGAGAGGG + Intergenic
1159327295 18:66938641-66938663 CTTTCTGTGCAGCGAGCAGCAGG + Intergenic
1161476155 19:4486773-4486795 CATATGGGGCACAGAGAAGCGGG - Intronic
1162106151 19:8371044-8371066 CTTTCTGGGCAGATGGAGGCTGG + Exonic
1162188750 19:8927931-8927953 CACTCTGGGCTGAGAGATGGAGG - Intronic
1163004775 19:14390221-14390243 CTTCCTGGAGAGAGAGAAGCTGG + Intronic
1163128349 19:15256713-15256735 TTTTCTGGGCAGAGAGGAGGTGG - Intronic
1164407321 19:27962450-27962472 AATCCTAGGCAGAGAGCAGCAGG + Intergenic
1164814136 19:31181408-31181430 CCATCTGAGCAGAGAGAAGAAGG + Intergenic
1165160057 19:33810846-33810868 CATGCTGGGCACAGGGCAGCCGG - Intronic
1165233133 19:34399889-34399911 CCTTCTTGGCAGAGTGGAGCTGG + Exonic
1166233664 19:41440858-41440880 CATTCTGGGCTGGGAGAGGATGG + Intergenic
1166703443 19:44895311-44895333 GATTCCAGGCAGGGAGAAGCAGG + Intronic
1202649615 1_KI270706v1_random:168842-168864 CATGCTGGGCAAAGCCAAGCTGG - Intergenic
1202696675 1_KI270712v1_random:131446-131468 CATTCTGGACGCAGAGGAGCTGG - Intergenic
926221263 2:10937138-10937160 CTTTCTGGGCAGAGGGGGGCAGG - Intergenic
926886660 2:17604519-17604541 CACTTTCCGCAGAGAGAAGCTGG + Intronic
927119179 2:19938675-19938697 CAATCTGAGCAGAGGGAAACAGG - Intronic
929227730 2:39527609-39527631 CATTCTGGACAAAGAGCAGTTGG - Intergenic
929486086 2:42356134-42356156 CATTCTAGGCAGAGGGAACATGG - Intronic
929588040 2:43128227-43128249 CAGTCTAGGTAGAGAGAAGAAGG + Intergenic
930435123 2:51331058-51331080 CATTCTGGGAAGAGGGTTGCAGG + Intergenic
930534442 2:52629557-52629579 CGCTCCGGGCAGAGAGAGGCCGG + Intergenic
931514832 2:63044110-63044132 CAGTCTGGCCAGAGAGCAGTTGG + Intronic
931916363 2:66961065-66961087 CATACTGGACACAGAGAATCTGG - Intergenic
932900647 2:75695850-75695872 CATCCTGGGCAGGATGAAGCAGG + Intronic
933007199 2:77010704-77010726 CATCCTGGGCAGAGAAAAGAAGG - Intronic
934277828 2:91588460-91588482 CATTCTGGACGCAGAGGAGCTGG - Intergenic
935765640 2:106365038-106365060 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
935945949 2:108286932-108286954 CATTTTTGGCAGGGAGAAACAGG + Intergenic
936146052 2:109981271-109981293 CCTTCTGAGCAGAGAGAGGCAGG - Intergenic
936198638 2:110390208-110390230 CCTTCTGAGCAGAGAGAGGCAGG + Intergenic
936467693 2:112767807-112767829 CTTTCTGTGCAGCGAGCAGCAGG - Intergenic
937232012 2:120403709-120403731 GAATATGGACAGAGAGAAGCAGG - Intergenic
937324730 2:120983648-120983670 CTATCTGGGCTGAGAGAACCAGG + Intronic
940075372 2:149735668-149735690 CATGCTGGGTAGTGAGCAGCAGG - Intergenic
940661340 2:156548791-156548813 TATTCAGGGCACAGAGAACCTGG + Intronic
940875880 2:158896574-158896596 CAGTCTGGGCTGGGAGCAGCAGG - Intergenic
941547568 2:166871444-166871466 CATTTAGGGCATAGAGAAACAGG - Intergenic
941671198 2:168294992-168295014 CATTCTGGCAACAGAGAACCAGG + Intergenic
942069802 2:172305900-172305922 CATTCTAGGCAAAAAGAAGGGGG + Intergenic
942483910 2:176419397-176419419 CAGTGTGGGAAGAGAGAAGGGGG - Intergenic
944417328 2:199491890-199491912 CCTTCTGGACAGAAAGAAGCGGG - Intergenic
944633555 2:201652765-201652787 TATCGGGGGCAGAGAGAAGCAGG - Intronic
946153496 2:217791787-217791809 CATTCTAGTCAGTGAAAAGCAGG - Intergenic
946938117 2:224742862-224742884 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
947483130 2:230521628-230521650 CTTTCTGTGCAGTGAGCAGCTGG + Intronic
947705708 2:232273773-232273795 CATGCTGGGAAGGGAGATGCTGG + Intronic
948080660 2:235202784-235202806 CATGCTGAGCACAGGGAAGCAGG - Intergenic
948795249 2:240399238-240399260 CAGTGTGGGCAGAGAGAGGTGGG - Intergenic
948884271 2:240875090-240875112 CTTTCTGGGGAGAAAGAAGCAGG - Exonic
1168830697 20:843900-843922 TATGCTGTGCTGAGAGAAGCTGG - Intronic
1169068415 20:2707347-2707369 GCTTCTGGGCAGAGGGAGGCTGG + Intronic
1169256295 20:4102479-4102501 CATTCTGGGGAGAGTACAGCAGG + Intergenic
1169304035 20:4472850-4472872 CTTTCTGGGGTGAGAGAAGGAGG - Intergenic
1170231140 20:14048114-14048136 CTTTCTGTGCAGTGAGCAGCAGG - Intronic
1172935780 20:38619142-38619164 CATTCCAGGCAGAGGGAAGAAGG + Intronic
1173846848 20:46193699-46193721 CATTCTGAGAACAGAGAGGCTGG - Intronic
1174059879 20:47825365-47825387 AATCCTGGGCCCAGAGAAGCAGG + Intergenic
1174071995 20:47905905-47905927 AATCCTGGGCCCAGAGAAGCAGG - Intergenic
1174147257 20:48460414-48460436 AATCCTGGGCCCAGAGAAGCAGG + Intergenic
1174152053 20:48492764-48492786 AATCCTGGGCCCAGAGAAGCAGG + Intergenic
1174432918 20:50483653-50483675 GGCTCTGGGCAGAGAGATGCGGG + Intergenic
1175225107 20:57440039-57440061 TATTCTGAGCAGCGGGAAGCTGG - Intergenic
1176267669 20:64219099-64219121 CATTTTGTGCAGAGAGCAGGTGG - Intronic
1176602207 21:8803705-8803727 CATGCTGGGCAAAGCCAAGCTGG + Intergenic
1176820657 21:13652198-13652220 CATGCTGGGCAAGGACAAGCTGG - Intergenic
1176967179 21:15224475-15224497 AATTCTTGGCAGAGAGTAGAGGG + Intergenic
1177277443 21:18931381-18931403 CAGTATGGAAAGAGAGAAGCAGG + Intergenic
1177639696 21:23830819-23830841 CTTTCTGGTCAGGGAGCAGCAGG + Intergenic
1178339793 21:31776437-31776459 CATTCTGATCAAAGAGAACCAGG - Intergenic
1178790069 21:35691677-35691699 CTTTCTGTGCAGTGAGCAGCAGG + Intronic
1178835486 21:36094041-36094063 CTTTCTGTGCAGTGAGAAGCGGG + Intergenic
1181329000 22:22074819-22074841 CAGTCTGGACAGAGAGCAGCAGG + Intergenic
1181333240 22:22111049-22111071 CAGTCTGGCCAGTGAGCAGCAGG + Intergenic
1181545123 22:23598223-23598245 CACTCTGGTCAAGGAGAAGCTGG - Intergenic
1181761253 22:25060108-25060130 CATTCTGGGCAAGGAAGAGCTGG - Intronic
1181948239 22:26535530-26535552 CACTTTGGGAAGAGTGAAGCAGG + Intronic
1181957975 22:26602018-26602040 CATCCTGGGGAAAGAGAGGCCGG + Exonic
1182278865 22:29206647-29206669 CATTTTGGACAGAGAAAAGAGGG + Intronic
1182462742 22:30494106-30494128 CCTCCTGGGGAGGGAGAAGCAGG - Intronic
1182653896 22:31874282-31874304 CCTTCTGTTCAGAGAGCAGCTGG - Exonic
1182718101 22:32376304-32376326 CAGTCTGGCGAGAGAGCAGCAGG + Intronic
1183511542 22:38238139-38238161 CATTCAGGGCAGAAAGAAGCAGG - Intronic
1183932783 22:41245808-41245830 CAGTCTGGGGAGGGAGAGGCAGG - Exonic
1184700718 22:46170839-46170861 CATTCCTGGCAGAAAGAAGTAGG + Intronic
1184846933 22:47093864-47093886 CTTTCTGTGCAGTGAGCAGCAGG - Intronic
1184950787 22:47841276-47841298 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
949134827 3:551723-551745 CTTTCTGTGCGGAGAGCAGCAGG + Intergenic
950187498 3:10954055-10954077 CATGCTGTGCTGAGAGCAGCTGG - Intergenic
950441912 3:13015405-13015427 CATTCCAGGCAGTGAGAAACGGG + Intronic
950534068 3:13569365-13569387 CAGTCTGGCCTGAGAGCAGCTGG - Intronic
952144661 3:30518726-30518748 AGTTCTGAGCAGAGAGATGCTGG - Intergenic
952258292 3:31714311-31714333 CTTGCTGGGCAGACAGTAGCTGG + Intronic
952576750 3:34783322-34783344 CATTCTGTTTATAGAGAAGCAGG - Intergenic
953102442 3:39842759-39842781 CACTGAGGGCAGACAGAAGCAGG - Intronic
953911038 3:46893162-46893184 CATTCCAGGCAGAGAACAGCAGG + Intronic
954133595 3:48572035-48572057 CATTCTGTGCAGGGTGAAGCTGG - Exonic
954510747 3:51122763-51122785 TCTTCTGGGCAGTGGGAAGCTGG - Intronic
954665462 3:52249087-52249109 CTTTCTGGGCAGATGGAAGCTGG - Intronic
955732762 3:62004665-62004687 CTTTCTGTGCAGCGAGCAGCCGG + Intronic
956114491 3:65904590-65904612 CATTCTGGGCTGAGGGATGGTGG - Intronic
956254791 3:67272292-67272314 CATTCTGGGCAGTAATAAGCAGG - Intergenic
956848962 3:73210868-73210890 CATTAGGAGCAGAGAGAGGCAGG + Intergenic
958169131 3:89916663-89916685 CATTCTGTGCAGTGAACAGCAGG - Intergenic
959212735 3:103409746-103409768 CATTCTAGGCAGAAAGAGGCAGG + Intergenic
959750926 3:109834137-109834159 GCTTCTGGGGTGAGAGAAGCTGG + Intergenic
961583072 3:127899278-127899300 GAAGCTGGCCAGAGAGAAGCTGG + Intergenic
961614544 3:128168464-128168486 CTTTCTGGGGAGAGAGAGGAAGG + Intronic
961747008 3:129070477-129070499 CTTTCTGTGCAGTGAGCAGCGGG - Intergenic
961979637 3:131063411-131063433 AATTCAGGGCATAGAGAAGATGG - Intronic
962874108 3:139522693-139522715 CATTCTAGGCAGAGTGAAAAAGG + Intronic
964137640 3:153363235-153363257 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
964732906 3:159886188-159886210 CAGTCTGGGCAGAAACAAACAGG - Exonic
966772687 3:183518011-183518033 TATTCCAGGCAGAGAGAACCTGG - Intronic
966939312 3:184735403-184735425 CATTCTGGTCAGCAAGCAGCCGG - Intergenic
966944064 3:184765253-184765275 CTTTCTGGACACAGAGGAGCTGG - Intergenic
967780232 3:193430419-193430441 CATTCTGGGTGAGGAGAAGCAGG + Intronic
967891446 3:194367038-194367060 CATGCTGGGCAGGGGGAAGGTGG - Intronic
968867608 4:3223723-3223745 CCTCCTGGTCAGTGAGAAGCTGG + Intronic
969066122 4:4482693-4482715 CATTCTGGGCAGAGAGAAGCAGG - Intronic
969636766 4:8373974-8373996 GCTCCTGGGCAGAGTGAAGCAGG + Intronic
969841043 4:9882220-9882242 CATCCTGGGAAGATAAAAGCAGG + Intronic
970720351 4:18981001-18981023 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
972652015 4:41027203-41027225 CTTTCTGTGCAGTGAGCAGCAGG + Intronic
972658669 4:41092385-41092407 CATTCTTGACAGTGAAAAGCAGG - Intronic
972966015 4:44510765-44510787 CATTCTCCTCAGAGAGAGGCGGG - Intergenic
973395062 4:49586942-49586964 CATGCTGGGCAAAGCCAAGCTGG - Intergenic
974618437 4:64322363-64322385 CTTTCTGTGCAGTGAGCAGCAGG + Intronic
975317509 4:72971713-72971735 CATCCTGGGCAGGATGAAGCAGG - Intergenic
976603370 4:86959782-86959804 CATTCTGGGCTGAAAGAACCAGG + Intronic
977218999 4:94316673-94316695 CATTCTAAGCAGAGAGAAAATGG - Intronic
977220426 4:94331862-94331884 AATTCTAGGCAGACAGCAGCAGG + Intronic
977486046 4:97647789-97647811 TGTTCTGGGCAGAGGGAAACAGG + Intronic
978387694 4:108192309-108192331 CCCTCTGGGCAGAGGGAATCAGG + Intergenic
982100327 4:151960842-151960864 CTTTCTGAGCAGACAGAAGCAGG - Intergenic
982226080 4:153167872-153167894 AATTCTGGGCAGAGGGATTCAGG - Intronic
982750774 4:159158584-159158606 CTTTGTGGGCAGGGAGAAGTAGG + Intronic
983238921 4:165209110-165209132 CTTCCTGGGCTGACAGAAGCAGG + Intronic
983583343 4:169330449-169330471 AATCCTGGGCAGAGAGAGGCAGG - Intergenic
983970062 4:173860512-173860534 CATGCAGGGCAGGAAGAAGCAGG - Intergenic
984030928 4:174603167-174603189 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
984389760 4:179113855-179113877 TATTTTGGGCAGAGAGTATCTGG + Intergenic
984417360 4:179478353-179478375 CATTAAGGGCAGTGGGAAGCAGG + Intergenic
984783673 4:183549059-183549081 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
985237165 4:187888133-187888155 AATTCTAGGCAAAGAGCAGCTGG + Intergenic
985284793 4:188326031-188326053 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
985295248 4:188430987-188431009 CTTTCTGTGCAGCGAGTAGCAGG - Intergenic
985411836 4:189693797-189693819 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
986072192 5:4296354-4296376 CATTCTTGTCAGTGAGAGGCTGG - Intergenic
986331175 5:6716961-6716983 CCTTCTGGGCACAGAGCAGGTGG - Intronic
986333686 5:6736915-6736937 CAGTCTCAGCAGAGAGAAACAGG - Intronic
987194739 5:15514959-15514981 CAAACTGGACAGAGAGAAGGTGG - Intronic
989235037 5:39137303-39137325 CATTATGGGGAGAGACAAGATGG + Intronic
989432361 5:41370820-41370842 CATTCAGGGCACAAGGAAGCAGG - Intronic
989732295 5:44663553-44663575 CAGTATGGGCAGAGAGAAAAAGG + Intergenic
991166217 5:63567325-63567347 CATTTTGGGTAGAGGGAAGGAGG - Intergenic
991183343 5:63779876-63779898 CATTCTGGGAACCAAGAAGCAGG - Intergenic
992366092 5:76091447-76091469 CATTCTGGGCAGTGAGAGGCAGG - Intronic
993404840 5:87499117-87499139 AATTCTAGGCAGACAGGAGCAGG + Intergenic
993882844 5:93382927-93382949 CATGCTGGGTAGAAAGAAGTGGG + Intergenic
994192272 5:96881748-96881770 CATTCTAGGCAGGAAGAAGGGGG + Intronic
995088297 5:108141167-108141189 CATCCTGGGCAGACAAAACCAGG - Intronic
996307244 5:122061519-122061541 CATTGTGGGCAGAGAAAAATGGG - Intronic
997999755 5:138615643-138615665 CAGCCAGGGCAGAGAGCAGCGGG + Intronic
998024598 5:138804475-138804497 CTTGCTGGGCAGTGGGAAGCAGG - Intronic
999201354 5:149818708-149818730 CATGGTAGGCAGAGAGGAGCGGG - Intronic
999277244 5:150339405-150339427 TATTCTGGGCAGGAAGGAGCAGG - Intergenic
1000109512 5:158094496-158094518 CATTCCAGGCAGATAAAAGCAGG - Intergenic
1000195616 5:158954705-158954727 CATCTTGGGCAGAGTGAGGCTGG - Intronic
1000328353 5:160188649-160188671 CCTTCTCCGCAGGGAGAAGCCGG - Intronic
1000343287 5:160294208-160294230 CAATCGGGGCAGAGAGAGGAAGG - Intronic
1000897993 5:166879441-166879463 CATTCTGGGCAGAGAAAACAAGG + Intergenic
1001043853 5:168356234-168356256 CATTCTGGAGAGAAAGTAGCAGG + Intronic
1001276593 5:170355749-170355771 GATTCTGAGCAGAGAGAGGGAGG - Intronic
1002397533 5:178969762-178969784 CAAACTGGGCAGAGTGGAGCTGG - Intergenic
1003178400 6:3771436-3771458 CACTAGGGGCAGAAAGAAGCCGG - Intergenic
1003333994 6:5153455-5153477 CCAGCTGGGCAGAGAGAAGCTGG + Intronic
1004329095 6:14705214-14705236 CATGCTGGCCAGACAGAAACAGG + Intergenic
1004472017 6:15937992-15938014 CATCCTGGACAGAGAGAGACAGG - Intergenic
1004543796 6:16577114-16577136 AGGTCTGGGCAGAGAAAAGCGGG - Intronic
1004567583 6:16813245-16813267 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
1006238845 6:32660166-32660188 AATTCTGGGCAGGCATAAGCAGG + Exonic
1007187394 6:39983962-39983984 CTTCCTGGGCAGAGAGGTGCAGG - Intergenic
1010463055 6:76134951-76134973 CATTCTGAGCTGACAGAATCAGG - Intergenic
1011030622 6:82918995-82919017 CCTCCTGTGCAGAGAGTAGCAGG + Intronic
1011476802 6:87756289-87756311 AATGCTGAGCAGGGAGAAGCAGG + Intergenic
1013038631 6:106411685-106411707 CAAGCTGGGGAGAGAGAAGCTGG + Intergenic
1013270118 6:108537498-108537520 CATTCTAGTCAGAGGGAAGCTGG + Intergenic
1013492025 6:110657156-110657178 CACTCTGTGCGGAGAGTAGCAGG + Intronic
1014070398 6:117175320-117175342 CAATCTGGCCACAGACAAGCTGG + Intergenic
1014960241 6:127674443-127674465 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1015468642 6:133576976-133576998 CAGCTTAGGCAGAGAGAAGCTGG - Intergenic
1015611700 6:135028277-135028299 AATGCTGGGCAGAGAGAAAGGGG + Intronic
1016238962 6:141905599-141905621 CAGCCTGGGCAGAGAGAGACTGG + Intergenic
1017110071 6:150924120-150924142 CCCACTGGGCAAAGAGAAGCAGG + Intronic
1017635339 6:156437585-156437607 CTTTCTGGGAAGAGGGCAGCTGG - Intergenic
1017658104 6:156649136-156649158 CAGCCTGAGCAGACAGAAGCTGG + Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1019020547 6:168914164-168914186 AAGTCTGGGCAGATGGAAGCAGG + Intergenic
1019186725 6:170224780-170224802 AATGCAGGGCAGAGGGAAGCGGG - Intergenic
1019963963 7:4484003-4484025 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1020111738 7:5451572-5451594 CATTCTGGGGAGGGAGCCGCAGG - Intronic
1021021452 7:15603319-15603341 CATTGTGGGCAGAGATCAGGAGG + Intergenic
1021645994 7:22789922-22789944 AATTCTGGGCAGACAGGATCGGG - Intergenic
1021723791 7:23531316-23531338 CTTTCCGGGCGGGGAGAAGCTGG - Intronic
1022247193 7:28571710-28571732 CATTCTGGGGATAAGGAAGCTGG - Intronic
1023106974 7:36772122-36772144 CATTCTGGTTACAGAGAAGATGG - Intergenic
1023494848 7:40784168-40784190 GCTTCCGGGCAAAGAGAAGCAGG + Intronic
1024062519 7:45709614-45709636 CATCCTGGGCAGTGGGGAGCTGG - Intronic
1024117558 7:46208350-46208372 CCTTCTGGTAAGGGAGAAGCAGG + Intergenic
1024654786 7:51442500-51442522 CCTTCTGTGCAGGGAGCAGCAGG - Intergenic
1025235032 7:57228637-57228659 AATCCTGGGCCCAGAGAAGCAGG - Intergenic
1026342372 7:69445530-69445552 GAGTCTGGGCAGATAGAAGTTGG - Intergenic
1026854386 7:73743323-73743345 AAATCTGGGAGGAGAGAAGCTGG - Intergenic
1028773604 7:94655796-94655818 AAGCCTGGGGAGAGAGAAGCTGG + Intronic
1029021844 7:97372325-97372347 CCTTCTGTGCAGTGAGCAGCAGG + Intergenic
1030199766 7:106890878-106890900 CATTCTGGGAAGAAAGCAGTGGG - Intronic
1032894563 7:136236265-136236287 CATTCTGTGCAGCAAGGAGCAGG - Intergenic
1034480808 7:151319317-151319339 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1035324002 7:158052986-158053008 CAGCCTGGGCAGGGAGAAGGCGG - Intronic
1035339473 7:158151217-158151239 CAGTGTGGGCAGGGAGAGGCAGG - Intronic
1035921817 8:3685390-3685412 CATTCTGTGCAGTGAGCAGCAGG - Intronic
1036889470 8:12586491-12586513 CATGCTGGGCAGGTAGAACCAGG + Intergenic
1037563286 8:20094345-20094367 GAGTCTGGGAAGAGTGAAGCAGG + Intergenic
1037973668 8:23193155-23193177 CTTTCTGTGCAGCGAGCAGCGGG + Intronic
1038289871 8:26239465-26239487 GTTTCTGGGCAGAGTGAAGGAGG - Intergenic
1038525934 8:28273391-28273413 CATTCAGGTCAGAGAGAACTGGG - Intergenic
1039197151 8:35045479-35045501 AATTCTGGGCATAGAGAAGAGGG - Intergenic
1039269719 8:35867742-35867764 ATTTCTGTGCAGAGAGCAGCAGG - Intergenic
1040650494 8:49443592-49443614 CTTTCTGTGCCGAGAGCAGCAGG - Intergenic
1040650502 8:49443692-49443714 CTTTCTGTGCCGAGAGCAGCAGG - Intergenic
1040659205 8:49549592-49549614 CTTTCTGTGCAGGGAGCAGCAGG - Intronic
1040659435 8:49553007-49553029 CTTTCTGTGCGGAGAGCAGCAGG + Intronic
1041029630 8:53723711-53723733 GGTTCTGGGCAGAGAGGAGATGG - Intronic
1041659835 8:60391073-60391095 TCTTCTGGGCATAGAGAAGTGGG + Intergenic
1041930983 8:63285978-63286000 CTATCTGGGGAGAAAGAAGCAGG - Intergenic
1042703579 8:71643415-71643437 CTTTCTGGGAAGAAAGAGGCAGG - Intergenic
1042886171 8:73554478-73554500 CCTTCTAGGCAGAAAGAAGCTGG + Intronic
1044014007 8:87028463-87028485 CCTTCTGTGCAGTGAGCAGCAGG - Intronic
1044274578 8:90285150-90285172 CATTCTGTGCTGAGAGCAGCAGG + Intergenic
1044449268 8:92314525-92314547 CATTCTTTGCAGAGAGTAGAGGG - Intergenic
1044837090 8:96306253-96306275 CATTATGGGCAGGGAGCAACTGG - Intronic
1047080832 8:121458524-121458546 CTTTCTGTGCAGAGAGCAGCAGG - Intergenic
1047105759 8:121728584-121728606 TACTCTGGACAGAGAGAGGCAGG + Intergenic
1047324609 8:123824482-123824504 TATTCTAGGCAGAGAAAAGAGGG - Intergenic
1047670704 8:127143082-127143104 CATTCTGTGCTGTGAGCAGCAGG - Intergenic
1048004651 8:130409486-130409508 CATGCTGGCCAGGGAGAAGAGGG - Intronic
1048586641 8:135780247-135780269 CATTCCAGTCAGAAAGAAGCGGG + Intergenic
1048804669 8:138228887-138228909 CAGACTGGGGACAGAGAAGCAGG + Intronic
1048987082 8:139740460-139740482 CATGCTGGGCAGGGGGAGGCAGG + Intronic
1049365242 8:142233901-142233923 GATTCTGTGCAGGGGGAAGCTGG - Intronic
1049443804 8:142620952-142620974 CATTCTGGGTGGAGGGAGGCTGG - Intergenic
1050336124 9:4591548-4591570 CATGCTGGGAAGACAGAAGCAGG - Intronic
1050793751 9:9509710-9509732 CTTTCTGTGCAGTGAGTAGCAGG + Intronic
1051333008 9:16042339-16042361 GATTCTGGCCTGAGAGAAGAGGG + Intronic
1053143748 9:35698169-35698191 CAGCCTGGGCAGAGAGAAAGTGG + Exonic
1055131938 9:72785705-72785727 CATCCTGGGCAGGGTGAAGTGGG + Intronic
1055189866 9:73504926-73504948 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
1055785981 9:79869377-79869399 GATTGTGGATAGAGAGAAGCAGG + Intergenic
1056059511 9:82869851-82869873 CATTCTAGGCAGACAGGGGCAGG + Intergenic
1056627054 9:88262564-88262586 CTTTCTGTGCTGAGAGCAGCAGG - Intergenic
1056983658 9:91341193-91341215 CATTGTGGGCAGTGGGAGGCTGG - Intronic
1057169592 9:92953513-92953535 CAGTGTGAGCAGCGAGAAGCTGG - Intronic
1057194233 9:93107866-93107888 CTTTCTGGGCTGGGAGAAGCTGG + Intronic
1057395787 9:94678851-94678873 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1057416789 9:94870920-94870942 CAATCAGGGCAGAGAGAGGAGGG - Intronic
1058120732 9:101135837-101135859 CCTGCTGGGCAGACAGAGGCAGG - Intronic
1058627332 9:106948561-106948583 TATTCTGGGTAGGGAGAGGCTGG - Intronic
1058810491 9:108634262-108634284 CAATCCGGGCAGTGAGAAGAAGG - Intergenic
1059419178 9:114180587-114180609 CCATCTGTGCAGAGAGGAGCTGG - Intronic
1060232593 9:121836687-121836709 GATGCAGGGCAGGGAGAAGCAGG + Intronic
1061204317 9:129154352-129154374 CATCTTGGGCAGAGAGGAGGGGG + Intergenic
1062000489 9:134213551-134213573 CATCCTGGGCAGGCAGGAGCAGG - Intergenic
1062211803 9:135368733-135368755 CTTTCTGTGCAGAGAGCCGCAGG + Intergenic
1203670760 Un_KI270755v1:9184-9206 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1186371165 X:8948930-8948952 CTTTCTTCTCAGAGAGAAGCAGG + Intergenic
1188043294 X:25395783-25395805 TATTCTGGGCAGTGTGAATCAGG + Intergenic
1188418683 X:29970496-29970518 TATTCCAGGCAGAGAGAATCAGG - Intergenic
1189672600 X:43426813-43426835 CAGACAGGGCGGAGAGAAGCTGG - Intergenic
1189722722 X:43936839-43936861 CAGACTGGGAAGTGAGAAGCTGG - Intergenic
1189992642 X:46609269-46609291 CACTCTTTGCAGAGGGAAGCAGG + Intronic
1190584266 X:51922436-51922458 CAGACTGGTCAGAAAGAAGCTGG + Intergenic
1193004938 X:76606003-76606025 CATTCTGGAGAGAGAGAACTTGG + Intergenic
1194212277 X:91083094-91083116 CATTGTGGGCAGTGAGAAGGAGG + Intergenic
1196294103 X:113979196-113979218 CTTTCTGTGCAGCGAGCAGCAGG + Intergenic
1196872386 X:120125317-120125339 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
1198699455 X:139382093-139382115 CAAAATGGGCAGAGAGATGCTGG - Intergenic
1200091284 X:153637290-153637312 GCTCCTGGGCAGAGAGAAGGTGG - Intergenic
1200418791 Y:2940607-2940629 CAGTCTGGGGAAAAAGAAGCAGG - Intronic
1200857912 Y:7959126-7959148 CATTGTGGGCAAACAGTAGCAGG + Intergenic