ID: 969069837

View in Genome Browser
Species Human (GRCh38)
Location 4:4527304-4527326
Sequence GGGAATTCACTCACAAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 219}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969069834_969069837 2 Left 969069834 4:4527279-4527301 CCTGTATAAAGATGAATTGTGCT 0: 1
1: 0
2: 1
3: 11
4: 146
Right 969069837 4:4527304-4527326 GGGAATTCACTCACAAAAAAAGG 0: 1
1: 0
2: 0
3: 18
4: 219
969069833_969069837 10 Left 969069833 4:4527271-4527293 CCTTTCTACCTGTATAAAGATGA 0: 1
1: 0
2: 1
3: 23
4: 252
Right 969069837 4:4527304-4527326 GGGAATTCACTCACAAAAAAAGG 0: 1
1: 0
2: 0
3: 18
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969069837 Original CRISPR GGGAATTCACTCACAAAAAA AGG Intronic
901719678 1:11186574-11186596 GGGAATTAACTGACAAAATCTGG - Intronic
903598438 1:24515232-24515254 GGGAGTGCATTCACAAAAGAAGG + Intronic
905712527 1:40118501-40118523 CTGAAGTCACTCACATAAAATGG + Intergenic
906637799 1:47421178-47421200 GGGAATAAACTAAGAAAAAAGGG - Intergenic
908165198 1:61450607-61450629 GGACATTCACACACATAAAACGG - Intronic
908669402 1:66530115-66530137 GAGAATTGAGTCACAAAGAAAGG - Intergenic
908897748 1:68919429-68919451 GGGAGTTGTCTCACAAAAAAGGG + Intergenic
910340707 1:86183797-86183819 GGGGACTCACTCTCAATAAAAGG - Intergenic
911395456 1:97301897-97301919 GGGAATGAAGTCAGAAAAAAAGG + Intronic
912561411 1:110554403-110554425 TGGAATTCTCTCACCAAGAAAGG + Intergenic
914219664 1:145668535-145668557 GGGTATTCAATCAGAAAAAGAGG - Intronic
915767757 1:158383148-158383170 CGGAATTCACCCAGAAGAAAGGG - Intergenic
916281457 1:163055788-163055810 GGGAACTCACTCATCAAGAAGGG + Intergenic
917002215 1:170372797-170372819 GGGCATTCAATTACAAAAAGAGG - Intergenic
917310584 1:173673969-173673991 GGGAGTTCACTAACCAGAAAAGG - Intergenic
918720029 1:187840901-187840923 GGGTAATCACTCCCAAAATAAGG + Intergenic
920228924 1:204457623-204457645 AGGTGTTCACTCACTAAAAAGGG - Intronic
920636322 1:207707827-207707849 GGGAATACGCAAACAAAAAATGG + Intronic
921521618 1:216162687-216162709 GGGAATTTACTCATAAAGGACGG + Intronic
922421354 1:225462924-225462946 GGGAACAGACTCACAAAGAATGG + Intergenic
1069671964 10:70214177-70214199 GGAAATTCCCTCTCAAAACATGG - Intronic
1071831904 10:89380348-89380370 GGGAAATGCCTCACAAAACATGG + Intronic
1071903121 10:90141993-90142015 AGGAATGCACTGACAAAAATTGG + Intergenic
1072282717 10:93883207-93883229 GGGAATTCAATCTGAAAGAAAGG + Intergenic
1074589869 10:114802467-114802489 GGAAATAAACTCTCAAAAAATGG + Intergenic
1078246672 11:9579421-9579443 GGAAATTAAATCACAATAAAGGG - Intronic
1079300068 11:19270073-19270095 GGGAGTGAAGTCACAAAAAAGGG + Intergenic
1080330515 11:31131831-31131853 AGCAAGTCACACACAAAAAAAGG + Intronic
1081025546 11:38009014-38009036 GTGTGTTCACTCACAAAAAGAGG - Intergenic
1081824993 11:46041198-46041220 GAAAATTCAGTTACAAAAAAAGG - Intronic
1082171053 11:49005957-49005979 GGGTAATCAAACACAAAAAATGG - Intergenic
1084076956 11:66786706-66786728 GGTAATTGAATCACAGAAAAGGG + Intronic
1084621365 11:70271913-70271935 AGGACTACCCTCACAAAAAAGGG - Intronic
1085077768 11:73606940-73606962 GGGAAGTCTCTCCCAAAAAAGGG + Intergenic
1086059534 11:82686080-82686102 GGGAATTTACTCAGTAAATAAGG - Intergenic
1086492165 11:87366467-87366489 GGAAATTCACTCAAAGACAAGGG - Intergenic
1086694852 11:89831130-89831152 GGGTAATCAAACACAAAAAATGG + Intergenic
1086711296 11:90013366-90013388 GGGTAATCAAACACAAAAAATGG - Intergenic
1088319909 11:108544824-108544846 GGGCACACACACACAAAAAATGG + Intronic
1088491610 11:110393809-110393831 GGGTATACAGTCACAAAAAAAGG - Intergenic
1090247729 11:125228816-125228838 GGGAATGCATTGGCAAAAAAGGG - Intronic
1091408839 12:225900-225922 AGGCAGTCACTCACAAAAGAGGG + Intronic
1091873408 12:3913826-3913848 GAGAATGCACTAAAAAAAAATGG - Intergenic
1095869827 12:47014324-47014346 GAGAATTTACTCACAGAAAGAGG - Intergenic
1096325967 12:50662316-50662338 AGGAATTCTCTCACAACAAGGGG + Intronic
1100743467 12:97620326-97620348 AGGAAATCACTCACAAATACAGG - Intergenic
1101170541 12:102088405-102088427 GAGAATACACTCAAAAAGAATGG + Intronic
1101753162 12:107599981-107600003 GGGCATTCACCCACAAACACAGG + Intronic
1102546872 12:113663635-113663657 GGGAAGTCAATCAATAAAAATGG - Intergenic
1106073617 13:26438009-26438031 AAGAAGTCACACACAAAAAATGG + Intergenic
1106352883 13:28951468-28951490 GAGAATGCACTCACAAAACTAGG - Intronic
1106895061 13:34291032-34291054 TGGAATTCACTGACATAGAAAGG + Intergenic
1108120602 13:47181835-47181857 GGGGATTCACTGACATAAGAGGG - Intergenic
1108572582 13:51766005-51766027 GAGCTGTCACTCACAAAAAAAGG + Exonic
1108629543 13:52268474-52268496 GAGAAGACACACACAAAAAATGG - Intergenic
1108656516 13:52538014-52538036 GAGAAGACACACACAAAAAATGG + Intergenic
1111022560 13:82472215-82472237 AGTAATTCAATCAGAAAAAAAGG - Intergenic
1113283384 13:108816034-108816056 GGCAATTCAATAAGAAAAAATGG + Intronic
1114937038 14:27551444-27551466 GGGAATTAACTCCTTAAAAATGG - Intergenic
1114946282 14:27685211-27685233 GGGAATTCACAAATAAGAAAAGG + Intergenic
1115103262 14:29728771-29728793 GGGTATTTACCCACAAGAAACGG - Intronic
1115833573 14:37372218-37372240 GGGAATACAATCACAATTAATGG + Intronic
1116673265 14:47871399-47871421 GGGAATATACTCCCAATAAACGG - Intergenic
1117997205 14:61489087-61489109 TGGAATTCACACACAGTAAAGGG + Intronic
1120441220 14:84542933-84542955 GGTAAGTCAATCATAAAAAAAGG + Intergenic
1121964854 14:98294801-98294823 GGGATTTCACTCACACAATTAGG - Intergenic
1126239167 15:46421458-46421480 GAAAATTCACACACAAAAAAAGG + Intergenic
1126288579 15:47044933-47044955 GGGAAATGAGGCACAAAAAAAGG + Intergenic
1128206255 15:65855033-65855055 GGCAATTCACACACACACAAAGG + Intronic
1130164788 15:81443026-81443048 AGAAATTCACACATAAAAAAAGG + Intergenic
1131488456 15:92841637-92841659 GGGAAGTCAATCACAAAAGGAGG - Intergenic
1134466184 16:14479984-14480006 GGGGATTCACTAACAATAAACGG + Intronic
1134774019 16:16836364-16836386 TGGAATTTTCTCAAAAAAAATGG + Intergenic
1136098229 16:27974170-27974192 GGGAATTCATGCAGAAAGAAAGG + Intronic
1138235470 16:55378675-55378697 GGGAAATTACTAACAGAAAAGGG - Intergenic
1140178872 16:72693986-72694008 GGGTATTCAATTACAAAAAGAGG - Intergenic
1143725035 17:8838847-8838869 GGGAATTCACTGTCCACAAAGGG - Intronic
1145687583 17:26689928-26689950 GGGAATAACATCACAAAAAAAGG + Intergenic
1145687975 17:26695603-26695625 GGGAATAGCCTCACATAAAAAGG + Intergenic
1152366195 17:79857919-79857941 GGGAATTCGCTCACACACTATGG + Intergenic
1157404682 18:47413036-47413058 GAGAGTACACTCATAAAAAAAGG - Intergenic
1158938863 18:62388613-62388635 GGGAATTCAATCACCAGAGAAGG - Exonic
1159003100 18:62990400-62990422 GGGATGTCACTAACAAAAAGAGG - Intergenic
1159119109 18:64148939-64148961 AGAAATTAACTCACAAGAAAGGG + Intergenic
1159319789 18:66831601-66831623 GGGAACTCTATCACAAAAACAGG + Intergenic
1159710536 18:71752488-71752510 GGGATGTCACCCACAACAAAGGG - Intronic
1160352896 18:78200239-78200261 GGGCATTCACACACAGAAATTGG - Intergenic
1161160514 19:2759189-2759211 GTGAATTTACCCACAATAAAAGG + Intronic
1162482343 19:10935477-10935499 GTGACTTCACTCACAAAGCAAGG - Intergenic
1162643560 19:12032383-12032405 TGGAAATCACCCACAACAAAAGG + Intronic
926088959 2:10037790-10037812 GGAAACTGACTCACAAACAATGG - Intergenic
929474861 2:42235861-42235883 GGAACTTAATTCACAAAAAATGG + Intronic
931832953 2:66071641-66071663 GGGAATTCACTAACCCATAATGG + Intergenic
933067290 2:77813775-77813797 GGGAATTAACATACATAAAAAGG + Intergenic
933435388 2:82243143-82243165 GGCTATTCACTCAGAAAAAGAGG + Intergenic
933894238 2:86795939-86795961 GTGAATTCACTTCCAAAAAGAGG + Intronic
935026318 2:99280526-99280548 GTGAATTACATCACAAAAAATGG - Intronic
938763695 2:134446425-134446447 TGTAATTCACCCAAAAAAAAAGG + Intronic
943506209 2:188762066-188762088 GGGAAATAACACAGAAAAAATGG + Intronic
943802998 2:192085979-192086001 GGGAATTGACACACAGAAAAAGG - Intronic
943948402 2:194096669-194096691 GGAAAGTGACTTACAAAAAATGG - Intergenic
944514628 2:200500308-200500330 GGGTATTCAGTTACAAAAAGAGG + Intronic
944609679 2:201389647-201389669 GAGAACTCTCTCACAAAAAAAGG + Intronic
944893936 2:204145029-204145051 GGGCATTCTCTCTCAGAAAATGG + Intergenic
945839157 2:214867749-214867771 GGAAATTTTCTGACAAAAAAGGG - Intergenic
1169181723 20:3574879-3574901 GGGAATTCACAAACAGGAAAAGG - Intronic
1171924247 20:31176017-31176039 TGGAATACACTCAAAAAGAATGG + Intergenic
1171943142 20:31350248-31350270 GGGAATTCATTCATGAAGAAGGG + Intergenic
1172759526 20:37312247-37312269 GGGACTTTAGTCACAAACAAGGG + Intronic
1173318256 20:41964165-41964187 GACAATTCAATAACAAAAAATGG - Intergenic
1174474226 20:50784701-50784723 GGGAAGTGACTTACAGAAAATGG + Intergenic
1176757756 21:10738305-10738327 TGGAATGCACTCAAATAAAATGG - Intergenic
1178621968 21:34185185-34185207 AGGAAGTCTCTAACAAAAAAGGG + Intergenic
1180579709 22:16820922-16820944 GGGTATTCTATCACAAAAGAGGG - Intronic
1182573679 22:31258418-31258440 AGGGATTCACTCACCATAAAAGG - Exonic
949360403 3:3225985-3226007 TGGAATTTTCTCTCAAAAAATGG + Intergenic
955593717 3:60565526-60565548 TGGATTTCATTTACAAAAAAGGG + Intronic
956515137 3:70038247-70038269 GAGAACTCACCCACAACAAAGGG - Intergenic
957306421 3:78463865-78463887 GGGTATTCAATCAGGAAAAAAGG - Intergenic
957357273 3:79107527-79107549 AAGAATTCACACACATAAAAAGG - Intronic
958081467 3:88751115-88751137 GGGAATTCAATTAGGAAAAAAGG + Intergenic
959401452 3:105907012-105907034 GAATATTCATTCACAAAAAATGG - Intergenic
960655652 3:120001183-120001205 GGGAACTCACTCATCAACAAGGG - Intronic
961095682 3:124154288-124154310 GGGTATTCAATTACAAAAACAGG + Intronic
965778693 3:172260712-172260734 GGGCATCCACTCCCCAAAAAAGG + Intronic
966537770 3:181053404-181053426 GGGTGTTCACTGAAAAAAAAGGG + Intergenic
966590800 3:181680594-181680616 AGGTATTATCTCACAAAAAATGG + Intergenic
966656117 3:182360377-182360399 GGGATTTCACTCAGAGCAAAAGG + Intergenic
967286615 3:187877403-187877425 GGGAATCCCATCACAATAAAAGG + Intergenic
968537541 4:1144055-1144077 TGGTATTCCCTAACAAAAAAAGG - Intergenic
969069837 4:4527304-4527326 GGGAATTCACTCACAAAAAAAGG + Intronic
971965793 4:33553717-33553739 GGGAGTTCACTCAAACAAGATGG + Intergenic
972147804 4:36050386-36050408 TGGAATTCTCTCGCAAAATAAGG + Intronic
972299821 4:37774114-37774136 GGGAATTCACTCATCACTAAGGG + Intergenic
973112061 4:46408827-46408849 GGGTATTCAATTAGAAAAAAAGG + Intronic
973561647 4:52143059-52143081 GGAAAATGACTCACAGAAAATGG + Intergenic
974649323 4:64733813-64733835 GGGAAATTTCTCCCAAAAAAAGG + Intergenic
977457734 4:97282769-97282791 GGGTATTCAATTACAAAAAGAGG + Intronic
978269120 4:106867237-106867259 GGGAATACAATCACAAAATGTGG - Intergenic
982032545 4:151315056-151315078 GGGATTCCATTCACCAAAAAAGG + Intronic
982216844 4:153090055-153090077 GGCATTTCAGTCACAACAAATGG + Intergenic
984459760 4:180019139-180019161 GGAAATACACTAACAAACAAGGG - Intergenic
984789329 4:183600517-183600539 GAGAATTTACTCAAGAAAAATGG - Intergenic
984942689 4:184947922-184947944 GGTAATTTACAAACAAAAAAAGG - Intergenic
984971543 4:185195848-185195870 GTGAATTATCTCACAAAAAAAGG - Intronic
986654233 5:9994886-9994908 GGGTATTCAATCAAGAAAAAAGG + Intergenic
987437573 5:17914739-17914761 GTGAATTTATTCACACAAAATGG - Intergenic
988315951 5:29628392-29628414 GGGAAGATACTGACAAAAAAAGG - Intergenic
988717886 5:33845944-33845966 GGGAACTCACTCCCACAAAATGG + Intronic
989785012 5:45316591-45316613 GGGTATTCAATTACAAAAAGAGG + Intronic
990009351 5:50977281-50977303 GACAATTCACTGAGAAAAAATGG - Intergenic
990169107 5:53028121-53028143 GGAAGTTCACACAGAAAAAAAGG - Intronic
990679001 5:58220067-58220089 GGGCATTCAATTACAAAAACAGG + Intergenic
991219059 5:64191051-64191073 TGGTATTCATTAACAAAAAAAGG - Intronic
991447581 5:66716876-66716898 GGGAATTCAGTCAAAACAGAAGG - Intronic
992072172 5:73158257-73158279 GAGAAGTCACCCCCAAAAAAGGG + Intergenic
992249769 5:74865878-74865900 GGGCATTCCCTCACACAAAATGG + Intronic
993361591 5:86983106-86983128 GGACATACACTCACAGAAAAGGG + Intergenic
993698279 5:91087896-91087918 TGGAATTTATTCACAAAAAAAGG - Intronic
994753009 5:103762541-103762563 TGGAATAGACTCACAAAACAAGG - Intergenic
995249333 5:109972281-109972303 GGGAAGTAACTTAAAAAAAATGG - Intergenic
995889258 5:116932521-116932543 GGGAATTGGCTCACAAGACAAGG + Intergenic
998965529 5:147536035-147536057 GTGACTTCACTCATGAAAAAGGG - Intergenic
999792710 5:154957172-154957194 TGGAATTCAATGACAAAAAAGGG + Exonic
1000122338 5:158209184-158209206 GGGGATTCACTCCCAAATAGTGG - Intergenic
1000832557 5:166121267-166121289 GGAAATTTAATCACAGAAAATGG + Intergenic
1001121923 5:168987898-168987920 GGTAGTGCACTCACAGAAAATGG - Intronic
1001896133 5:175382976-175382998 GGCACTTAATTCACAAAAAAGGG + Intergenic
1003203838 6:3989451-3989473 GGGAATCCTCACACAAAACAGGG + Intergenic
1003434681 6:6075311-6075333 AATAATTCACTCACAAATAATGG + Intergenic
1004242206 6:13934494-13934516 GAGAAGTCACTCAGAAAAATAGG - Intronic
1008193910 6:48494738-48494760 GGGTATTCAATTACGAAAAAAGG + Intergenic
1009291802 6:61891928-61891950 GGGTATTCAATCATGAAAAAAGG + Intronic
1009526266 6:64750775-64750797 GGGAATTCACTGAAAAGCAAAGG + Intronic
1010503049 6:76624801-76624823 GGGTATTCAATTACAAAAAGAGG - Intergenic
1010541826 6:77100771-77100793 TTGAATTCACTAATAAAAAAGGG - Intergenic
1011865437 6:91820364-91820386 GGCAATTGACACACAAAAAAAGG - Intergenic
1014918360 6:127181901-127181923 GGTAATTCATTCAAAAAAAGAGG + Intronic
1017653933 6:156608852-156608874 GGACATTCAATCACGAAAAAAGG + Intergenic
1017687993 6:156932229-156932251 GGAAACTGACTCACAAACAAAGG - Intronic
1018175169 6:161172296-161172318 GGGTATTCACTCACCCTAAAGGG - Intronic
1018782697 6:167082901-167082923 GGGTATTCACTTAGGAAAAAAGG - Intergenic
1020595074 7:10196503-10196525 GAAAATTCACTCACACAAAATGG + Intergenic
1021154645 7:17195064-17195086 GGAACTTCACTCAAAAAGAAAGG + Intergenic
1021931355 7:25584428-25584450 GAGGATGCACTCACAAAAGATGG - Intergenic
1022450675 7:30511617-30511639 GAGAATTAACTCTCACAAAATGG - Intronic
1022582934 7:31574854-31574876 GTGACTTCACACACAAAAGATGG + Intronic
1027445144 7:78265410-78265432 GGGAATTCAATAGCATAAAATGG + Intronic
1028442351 7:90878634-90878656 GAGAAGTCACTGACAAAATATGG + Intronic
1030008468 7:105141395-105141417 TGGCATTCACTCCCAAAATAAGG + Intronic
1030353649 7:108519662-108519684 GGGAATTCTACCACAAAATATGG + Intronic
1033256907 7:139809462-139809484 GGGAATTGGCTCACAAACTATGG + Intronic
1035983504 8:4399985-4400007 GGGAATTCACTTGGAAAGAAAGG - Intronic
1037078428 8:14752040-14752062 GAGAATTCAACCACAAAGAAGGG + Intronic
1038166038 8:25085911-25085933 AGGAATTCAAACAAAAAAAAAGG + Intergenic
1043920518 8:85978129-85978151 GGGTATTCACTATCAAAATAAGG + Intergenic
1046235353 8:111417159-111417181 GGGAATTGTCTCACACAATATGG + Intergenic
1046341044 8:112854656-112854678 GGGAATTCACTGAGAAGGAATGG + Intronic
1047060373 8:121218866-121218888 GTAAATACACTCACCAAAAATGG + Intergenic
1049365858 8:142236520-142236542 GGGACTTCAGTCACAGAAACAGG - Intronic
1050127798 9:2377443-2377465 TAAAATTCACTCACAAAAAATGG + Intergenic
1050914487 9:11114596-11114618 GGGAAATGACACACATAAAATGG + Intergenic
1051105555 9:13575654-13575676 GGGGAATGACTCACAAACAAGGG - Intergenic
1051645250 9:19261809-19261831 GAGAACACACACACAAAAAACGG - Intronic
1051971018 9:22887368-22887390 GAAAAATCACACACAAAAAATGG - Intergenic
1052066408 9:24026854-24026876 GAGAATTCACTCACTATCAAAGG - Intergenic
1052426364 9:28310185-28310207 AGGTATTTACTCACAAGAAATGG + Intronic
1053296424 9:36917451-36917473 GGGGATTCCCTTACAAAAACTGG - Intronic
1055360425 9:75483887-75483909 GGGTATTCACCCACCAGAAATGG - Intergenic
1057557973 9:96102712-96102734 GAGAACTCACTCACCAACAAGGG + Intergenic
1057619232 9:96619830-96619852 GGCGCTTCATTCACAAAAAAGGG + Exonic
1057853389 9:98582830-98582852 GGGATTTCACACACCAAGAAGGG - Intronic
1058560484 9:106223819-106223841 GGCATTTCCCTCAAAAAAAATGG - Intergenic
1059217866 9:112583110-112583132 GGGAATTCTCTCACATAGATAGG - Intronic
1061320637 9:129826417-129826439 GGGAATTCACAGATAAACAAGGG - Intergenic
1203727893 Un_GL000216v2:65274-65296 TTGAATAGACTCACAAAAAATGG - Intergenic
1203392618 Un_KI270438v1:110750-110772 GGGAATGGACTCAAAAGAAATGG + Intergenic
1203392761 Un_KI270438v1:112033-112055 GGGAATGCACTCAAAAGAAATGG + Intergenic
1186110750 X:6253303-6253325 GAGAATTCAACCAAAAAAAATGG + Intergenic
1186913101 X:14190875-14190897 GGATTTTCACACACAAAAAATGG + Intergenic
1188174363 X:26970472-26970494 AGAAATTCACACAAAAAAAATGG - Intergenic
1188439153 X:30197491-30197513 GGGAATTGGCTCACAAAATTAGG - Intergenic
1188502687 X:30845754-30845776 GGCAAATCACTCAAAAAATAGGG - Intronic
1190520146 X:51270375-51270397 GTCAATACACACACAAAAAATGG + Intergenic
1191695070 X:63981050-63981072 AGTACTTCAATCACAAAAAAAGG + Intergenic
1191864157 X:65690475-65690497 GTGAACTCACTCTCTAAAAAGGG - Intronic
1192983611 X:76372893-76372915 GAAAATTCATTCACAAATAAAGG + Intergenic
1193207338 X:78764685-78764707 GGGAACTCAGGCACAAAGAAAGG - Intergenic
1193271373 X:79533486-79533508 GGGAAGTCCATCACAAAAAAAGG - Intergenic
1194220165 X:91179874-91179896 GGGAAATCATTGAAAAAAAAAGG + Intergenic
1194988752 X:100521552-100521574 GGCAATTCACCCACAAACAAAGG + Intergenic
1195780346 X:108455739-108455761 GGTAATTCAATGAAAAAAAAAGG - Intronic
1198306778 X:135391445-135391467 GGGAATTCTCTCAAGATAAAGGG - Intergenic
1198843639 X:140885591-140885613 GGACATTCACTGGCAAAAAAGGG + Intergenic
1198859448 X:141054147-141054169 GGGTATACACACCCAAAAAAAGG - Intergenic
1198903247 X:141533244-141533266 GGGTATACACACCCAAAAAAAGG + Intergenic
1199604022 X:149562340-149562362 AATAATTCAGTCACAAAAAAAGG + Intergenic
1201246515 Y:12009341-12009363 GGGTATTCACTTAGGAAAAAAGG - Intergenic