ID: 969075867

View in Genome Browser
Species Human (GRCh38)
Location 4:4577250-4577272
Sequence CCTAGCATGGGGAGGAGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969075867_969075885 26 Left 969075867 4:4577250-4577272 CCCCACCTCCTCCCCATGCTAGG No data
Right 969075885 4:4577299-4577321 GTCCTGGCTTTCATGTGAGCAGG No data
969075867_969075882 10 Left 969075867 4:4577250-4577272 CCCCACCTCCTCCCCATGCTAGG No data
Right 969075882 4:4577283-4577305 CTCCCATCTTTCTAGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969075867 Original CRISPR CCTAGCATGGGGAGGAGGTG GGG (reversed) Intergenic
No off target data available for this crispr