ID: 969079337

View in Genome Browser
Species Human (GRCh38)
Location 4:4606425-4606447
Sequence CTCTGCTGACACCTTGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969079337_969079339 2 Left 969079337 4:4606425-4606447 CCAGAATCAAGGTGTCAGCAGAG No data
Right 969079339 4:4606450-4606472 GTGCTCCCCCTGAAACCTCCAGG No data
969079337_969079340 3 Left 969079337 4:4606425-4606447 CCAGAATCAAGGTGTCAGCAGAG No data
Right 969079340 4:4606451-4606473 TGCTCCCCCTGAAACCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969079337 Original CRISPR CTCTGCTGACACCTTGATTC TGG (reversed) Intergenic
No off target data available for this crispr