ID: 969080399

View in Genome Browser
Species Human (GRCh38)
Location 4:4613334-4613356
Sequence TTCTGCCACCACTAACAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969080399_969080404 16 Left 969080399 4:4613334-4613356 CCACACTGTTAGTGGTGGCAGAA No data
Right 969080404 4:4613373-4613395 AAAGTCCACCGGAACTGGAAAGG No data
969080399_969080402 5 Left 969080399 4:4613334-4613356 CCACACTGTTAGTGGTGGCAGAA No data
Right 969080402 4:4613362-4613384 GAAGCAATCTGAAAGTCCACCGG No data
969080399_969080403 11 Left 969080399 4:4613334-4613356 CCACACTGTTAGTGGTGGCAGAA No data
Right 969080403 4:4613368-4613390 ATCTGAAAGTCCACCGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969080399 Original CRISPR TTCTGCCACCACTAACAGTG TGG (reversed) Intergenic
No off target data available for this crispr