ID: 969080402

View in Genome Browser
Species Human (GRCh38)
Location 4:4613362-4613384
Sequence GAAGCAATCTGAAAGTCCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969080399_969080402 5 Left 969080399 4:4613334-4613356 CCACACTGTTAGTGGTGGCAGAA No data
Right 969080402 4:4613362-4613384 GAAGCAATCTGAAAGTCCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969080402 Original CRISPR GAAGCAATCTGAAAGTCCAC CGG Intergenic
No off target data available for this crispr