ID: 969080403

View in Genome Browser
Species Human (GRCh38)
Location 4:4613368-4613390
Sequence ATCTGAAAGTCCACCGGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969080399_969080403 11 Left 969080399 4:4613334-4613356 CCACACTGTTAGTGGTGGCAGAA No data
Right 969080403 4:4613368-4613390 ATCTGAAAGTCCACCGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969080403 Original CRISPR ATCTGAAAGTCCACCGGAAC TGG Intergenic
No off target data available for this crispr