ID: 969080404

View in Genome Browser
Species Human (GRCh38)
Location 4:4613373-4613395
Sequence AAAGTCCACCGGAACTGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969080401_969080404 -8 Left 969080401 4:4613358-4613380 CCTGGAAGCAATCTGAAAGTCCA No data
Right 969080404 4:4613373-4613395 AAAGTCCACCGGAACTGGAAAGG No data
969080399_969080404 16 Left 969080399 4:4613334-4613356 CCACACTGTTAGTGGTGGCAGAA No data
Right 969080404 4:4613373-4613395 AAAGTCCACCGGAACTGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969080404 Original CRISPR AAAGTCCACCGGAACTGGAA AGG Intergenic
No off target data available for this crispr