ID: 969091128

View in Genome Browser
Species Human (GRCh38)
Location 4:4694732-4694754
Sequence CAGTCACAGGAGAGGTAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969091128_969091136 10 Left 969091128 4:4694732-4694754 CCTCATTACCTCTCCTGTGACTG No data
Right 969091136 4:4694765-4694787 CAGCATGGAAGCCCGTCATCTGG No data
969091128_969091134 -5 Left 969091128 4:4694732-4694754 CCTCATTACCTCTCCTGTGACTG No data
Right 969091134 4:4694750-4694772 GACTGGGCAGCCTGGCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969091128 Original CRISPR CAGTCACAGGAGAGGTAATG AGG (reversed) Intergenic
No off target data available for this crispr