ID: 969095976

View in Genome Browser
Species Human (GRCh38)
Location 4:4733251-4733273
Sequence CCACTTTCAGAGCCTCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969095973_969095976 -2 Left 969095973 4:4733230-4733252 CCTCACTTGTGAATCTTTTCTCC No data
Right 969095976 4:4733251-4733273 CCACTTTCAGAGCCTCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969095976 Original CRISPR CCACTTTCAGAGCCTCTGCA GGG Intergenic
No off target data available for this crispr