ID: 969096419

View in Genome Browser
Species Human (GRCh38)
Location 4:4736010-4736032
Sequence CTGGACTTCTTGGAAAGTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969096411_969096419 21 Left 969096411 4:4735966-4735988 CCCGTGATTACGTAGTGGTTCCC No data
Right 969096419 4:4736010-4736032 CTGGACTTCTTGGAAAGTTTTGG No data
969096416_969096419 -1 Left 969096416 4:4735988-4736010 CCAGATGATTACGATGCGGTGTC No data
Right 969096419 4:4736010-4736032 CTGGACTTCTTGGAAAGTTTTGG No data
969096415_969096419 0 Left 969096415 4:4735987-4736009 CCCAGATGATTACGATGCGGTGT No data
Right 969096419 4:4736010-4736032 CTGGACTTCTTGGAAAGTTTTGG No data
969096410_969096419 22 Left 969096410 4:4735965-4735987 CCCCGTGATTACGTAGTGGTTCC No data
Right 969096419 4:4736010-4736032 CTGGACTTCTTGGAAAGTTTTGG No data
969096414_969096419 1 Left 969096414 4:4735986-4736008 CCCCAGATGATTACGATGCGGTG No data
Right 969096419 4:4736010-4736032 CTGGACTTCTTGGAAAGTTTTGG No data
969096412_969096419 20 Left 969096412 4:4735967-4735989 CCGTGATTACGTAGTGGTTCCCC No data
Right 969096419 4:4736010-4736032 CTGGACTTCTTGGAAAGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969096419 Original CRISPR CTGGACTTCTTGGAAAGTTT TGG Intergenic
No off target data available for this crispr