ID: 969101986

View in Genome Browser
Species Human (GRCh38)
Location 4:4776298-4776320
Sequence GGAAGAAGACCTTTAGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969101986_969101990 28 Left 969101986 4:4776298-4776320 CCCTTTGCTAAAGGTCTTCTTCC No data
Right 969101990 4:4776349-4776371 TTCCCTTCCAGACTTGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969101986 Original CRISPR GGAAGAAGACCTTTAGCAAA GGG (reversed) Intergenic
No off target data available for this crispr