ID: 969111462

View in Genome Browser
Species Human (GRCh38)
Location 4:4846938-4846960
Sequence TCCCCAGGAGAGTCCCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969111442_969111462 25 Left 969111442 4:4846890-4846912 CCCCCCACCCCCACCACAGGCAA No data
Right 969111462 4:4846938-4846960 TCCCCAGGAGAGTCCCAGGGAGG No data
969111446_969111462 21 Left 969111446 4:4846894-4846916 CCACCCCCACCACAGGCAACCGG No data
Right 969111462 4:4846938-4846960 TCCCCAGGAGAGTCCCAGGGAGG No data
969111457_969111462 -8 Left 969111457 4:4846923-4846945 CCAAGATCACTGCCATCCCCAGG No data
Right 969111462 4:4846938-4846960 TCCCCAGGAGAGTCCCAGGGAGG No data
969111452_969111462 17 Left 969111452 4:4846898-4846920 CCCCACCACAGGCAACCGGGGGC No data
Right 969111462 4:4846938-4846960 TCCCCAGGAGAGTCCCAGGGAGG No data
969111456_969111462 2 Left 969111456 4:4846913-4846935 CCGGGGGCTACCAAGATCACTGC No data
Right 969111462 4:4846938-4846960 TCCCCAGGAGAGTCCCAGGGAGG No data
969111454_969111462 15 Left 969111454 4:4846900-4846922 CCACCACAGGCAACCGGGGGCTA No data
Right 969111462 4:4846938-4846960 TCCCCAGGAGAGTCCCAGGGAGG No data
969111455_969111462 12 Left 969111455 4:4846903-4846925 CCACAGGCAACCGGGGGCTACCA No data
Right 969111462 4:4846938-4846960 TCCCCAGGAGAGTCCCAGGGAGG No data
969111453_969111462 16 Left 969111453 4:4846899-4846921 CCCACCACAGGCAACCGGGGGCT No data
Right 969111462 4:4846938-4846960 TCCCCAGGAGAGTCCCAGGGAGG No data
969111450_969111462 18 Left 969111450 4:4846897-4846919 CCCCCACCACAGGCAACCGGGGG No data
Right 969111462 4:4846938-4846960 TCCCCAGGAGAGTCCCAGGGAGG No data
969111443_969111462 24 Left 969111443 4:4846891-4846913 CCCCCACCCCCACCACAGGCAAC No data
Right 969111462 4:4846938-4846960 TCCCCAGGAGAGTCCCAGGGAGG No data
969111445_969111462 22 Left 969111445 4:4846893-4846915 CCCACCCCCACCACAGGCAACCG No data
Right 969111462 4:4846938-4846960 TCCCCAGGAGAGTCCCAGGGAGG No data
969111444_969111462 23 Left 969111444 4:4846892-4846914 CCCCACCCCCACCACAGGCAACC No data
Right 969111462 4:4846938-4846960 TCCCCAGGAGAGTCCCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969111462 Original CRISPR TCCCCAGGAGAGTCCCAGGG AGG Intergenic
No off target data available for this crispr