ID: 969112388

View in Genome Browser
Species Human (GRCh38)
Location 4:4852070-4852092
Sequence GTCCTTCCCCACCCCGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969112388_969112406 22 Left 969112388 4:4852070-4852092 CCCACCCCGGGGTGGGGAAGGAC No data
Right 969112406 4:4852115-4852137 CCAGGTTGGGGTGGGGGCTGTGG No data
969112388_969112398 10 Left 969112388 4:4852070-4852092 CCCACCCCGGGGTGGGGAAGGAC No data
Right 969112398 4:4852103-4852125 TCCATAGCAAACCCAGGTTGGGG No data
969112388_969112402 15 Left 969112388 4:4852070-4852092 CCCACCCCGGGGTGGGGAAGGAC No data
Right 969112402 4:4852108-4852130 AGCAAACCCAGGTTGGGGTGGGG No data
969112388_969112403 16 Left 969112388 4:4852070-4852092 CCCACCCCGGGGTGGGGAAGGAC No data
Right 969112403 4:4852109-4852131 GCAAACCCAGGTTGGGGTGGGGG No data
969112388_969112395 4 Left 969112388 4:4852070-4852092 CCCACCCCGGGGTGGGGAAGGAC No data
Right 969112395 4:4852097-4852119 CTATTCTCCATAGCAAACCCAGG No data
969112388_969112397 9 Left 969112388 4:4852070-4852092 CCCACCCCGGGGTGGGGAAGGAC No data
Right 969112397 4:4852102-4852124 CTCCATAGCAAACCCAGGTTGGG No data
969112388_969112401 14 Left 969112388 4:4852070-4852092 CCCACCCCGGGGTGGGGAAGGAC No data
Right 969112401 4:4852107-4852129 TAGCAAACCCAGGTTGGGGTGGG No data
969112388_969112400 13 Left 969112388 4:4852070-4852092 CCCACCCCGGGGTGGGGAAGGAC No data
Right 969112400 4:4852106-4852128 ATAGCAAACCCAGGTTGGGGTGG No data
969112388_969112396 8 Left 969112388 4:4852070-4852092 CCCACCCCGGGGTGGGGAAGGAC No data
Right 969112396 4:4852101-4852123 TCTCCATAGCAAACCCAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969112388 Original CRISPR GTCCTTCCCCACCCCGGGGT GGG (reversed) Intergenic
No off target data available for this crispr