ID: 969114102

View in Genome Browser
Species Human (GRCh38)
Location 4:4860474-4860496
Sequence AGCCCACGGCTCCCTAGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969114102_969114108 17 Left 969114102 4:4860474-4860496 CCGGTGCTAGGGAGCCGTGGGCT 0: 1
1: 0
2: 1
3: 8
4: 109
Right 969114108 4:4860514-4860536 GCCTCCCTCCACTCCCACCCAGG 0: 1
1: 0
2: 5
3: 84
4: 784
969114102_969114112 24 Left 969114102 4:4860474-4860496 CCGGTGCTAGGGAGCCGTGGGCT 0: 1
1: 0
2: 1
3: 8
4: 109
Right 969114112 4:4860521-4860543 TCCACTCCCACCCAGGAAGAAGG 0: 1
1: 0
2: 2
3: 21
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969114102 Original CRISPR AGCCCACGGCTCCCTAGCAC CGG (reversed) Intronic
902178001 1:14665805-14665827 AGCACACGGCTGCCTAGTTCGGG + Intronic
902332815 1:15738892-15738914 AGCCCCCGGGTCCCAGGCACAGG + Intronic
904663537 1:32102710-32102732 AGCCAAGGGCTCCCTGGCAAGGG + Exonic
909395828 1:75169716-75169738 AGCCCACAGCTCCATTGCTCTGG + Intergenic
921214809 1:212927874-212927896 AGCCCACGGCTCTATAGGAAGGG - Intergenic
1064565022 10:16631321-16631343 AGCCCAGGGCGCACTGGCACTGG + Intronic
1066492397 10:35906455-35906477 AGCCCATGGCTCTCTAGTCCCGG + Intergenic
1072735737 10:97878145-97878167 AGCCCACTGCTCCCCAGGCCAGG - Intronic
1074400988 10:113141115-113141137 AGCCCAGGGCTTCAGAGCACCGG - Intronic
1074833026 10:117263219-117263241 AGCCCATGGCTCCCTGACCCTGG + Intronic
1075180801 10:120209141-120209163 AGCCCAAGACACCCTAGCAGGGG - Intergenic
1075335226 10:121604032-121604054 TGCCCACTGCTCCCCAGCAGCGG + Intergenic
1076692866 10:132232675-132232697 AGCCCAGGGCTCCGGAGCCCGGG - Intronic
1077046734 11:550013-550035 AGCCCAGGCCTCCCCAGCCCAGG - Intronic
1077181528 11:1219250-1219272 AGCCTCCTGCTCCCTGGCACGGG - Intergenic
1077349727 11:2086901-2086923 AGCCCACGGCCCCATAGCGTTGG - Intergenic
1078606918 11:12785138-12785160 TCCCCACGGCTCCCAGGCACAGG - Intronic
1080503101 11:32888478-32888500 AGCCCACGCCTACCCAGAACAGG + Intergenic
1085465397 11:76719926-76719948 AGCCCACAGTTCTCTAGCCCTGG + Intergenic
1086126838 11:83357321-83357343 AGCCCTGGGCTACCTACCACTGG - Intergenic
1089082423 11:115788016-115788038 AACCCCTGGCTCCCCAGCACAGG - Intergenic
1091149539 11:133314758-133314780 TGCCCACGGCTCCCAAGCAATGG + Intronic
1100146664 12:91686770-91686792 AGCACATGGCTCCGTAACACTGG - Intergenic
1107740446 13:43444919-43444941 AACCCAGGTCTCCCTAGCCCAGG - Intronic
1108689117 13:52846573-52846595 AGCCAATGGCTCCCTAGAAGTGG - Exonic
1111397491 13:87683015-87683037 AGACCATGGCTTACTAGCACAGG + Exonic
1119472738 14:74909731-74909753 CGGCCACAGCCCCCTAGCACCGG + Exonic
1122178766 14:99939577-99939599 CCCCCACGGCTCCCTTGCTCCGG + Intronic
1122784305 14:104156801-104156823 AGCCCACGTCCCCTCAGCACGGG + Intronic
1124725105 15:32149305-32149327 AGCACAGGGCTGCCCAGCACTGG + Intronic
1128780087 15:70353577-70353599 AGCCCGGGGCTGCCTAGCTCAGG - Intergenic
1132570170 16:641041-641063 AGCACAGGGCCCCCCAGCACAGG + Intronic
1132570194 16:641090-641112 AGCACAGGGCCCCCCAGCACAGG + Intronic
1132570298 16:641384-641406 AGCACAGGGCCCCCCAGCACAGG + Intronic
1133701056 16:8309431-8309453 AGTGGACAGCTCCCTAGCACTGG - Intergenic
1134038265 16:11048694-11048716 AGCCCACGGGGGCCTGGCACAGG - Intronic
1136394205 16:29984038-29984060 GGCACAGGGCTCCCCAGCACTGG - Intronic
1136412098 16:30083575-30083597 AGCCCAGGGCTCCATGGGACAGG + Intronic
1141249452 16:82341894-82341916 AGTCCACGGCCCTCTAGGACAGG + Intergenic
1141618299 16:85222309-85222331 AGCGCACGGCTCTCCAGCCCAGG + Intergenic
1142143110 16:88481320-88481342 ACCCCACGCCTCCCTCGCCCTGG - Intronic
1142526209 17:543565-543587 AGCCGTGGGCTCCCTAGCAGGGG - Intronic
1143499797 17:7332015-7332037 AGCCCAACACTCCCTACCACAGG + Intergenic
1146981147 17:37162932-37162954 TGCCCATGTCTCACTAGCACTGG - Intronic
1148351169 17:46943095-46943117 AGCCATCGGCTCCCTACCCCTGG - Intronic
1148352603 17:46951439-46951461 AGCCCACGTCTCCAGATCACAGG + Intronic
1151655337 17:75493178-75493200 TGCCCAGGCCTCCCTAGCAATGG - Intronic
1152029387 17:77832291-77832313 AGCCCAGGGGTCCCCAGCCCCGG + Intergenic
1152302070 17:79500862-79500884 AGCAAACGTGTCCCTAGCACGGG - Intronic
1155450614 18:25959216-25959238 AGCTCACGGCTCCCAAAGACAGG + Intergenic
1160982677 19:1823529-1823551 TGCCCACGGCCCCCCGGCACAGG + Intronic
1161245577 19:3249826-3249848 AGCCCACTGCTCCCTATCCCAGG + Intronic
1165092678 19:33395077-33395099 AGGCCACGGGTCCCAAGAACTGG + Intronic
1165437157 19:35802191-35802213 TGACCACGTCTCTCTAGCACTGG - Exonic
1165730481 19:38141634-38141656 AACCCAGAGCTCCCCAGCACTGG - Intronic
1168590896 19:57633500-57633522 AGCTCACGTCTCTGTAGCACAGG + Intronic
926681298 2:15665897-15665919 TCCCCACGCCTCCCCAGCACTGG + Intergenic
927705724 2:25295257-25295279 AGCCCCCGCCTCCCTATCATGGG + Intronic
928278027 2:29920380-29920402 GGCCCGCGGCTCGCTAGCTCTGG - Exonic
931377253 2:61718515-61718537 AGCCCACGGGTCCGTGGCCCGGG - Intergenic
934117519 2:88811140-88811162 GGACCATGGCTCCCCAGCACAGG + Intergenic
934858265 2:97742236-97742258 GGTCCACGGCTTCCTAGCATTGG + Intergenic
936161120 2:110084876-110084898 GGACCACGGCTCCCCAGCACAGG + Exonic
936183543 2:110286478-110286500 GGACCACGGCTCCCCAGCACAGG - Intergenic
937313364 2:120915713-120915735 AGACCAAGGCTCCCTAGCAAGGG + Intronic
947678847 2:232011166-232011188 AGCCCACTGGTCCCTAGAAAAGG - Intronic
948524117 2:238559926-238559948 AGCCCACAGCTCTCTTGCATAGG + Intergenic
1169325127 20:4669630-4669652 AGCCCAGGGCATCCTGGCACTGG - Intergenic
1170830286 20:19833791-19833813 AGCCCGTGGCTGACTAGCACAGG + Intergenic
1174069408 20:47889213-47889235 AGCCAGCGACTCCCGAGCACAGG - Intergenic
1175955443 20:62606721-62606743 AGCCCAGTGCTCCCTAGCACGGG - Intergenic
1176060231 20:63169301-63169323 AGCCCACAGATCCCAGGCACAGG + Intergenic
1181058696 22:20271801-20271823 ACCCCCCAGCTCCCTGGCACTGG - Intronic
1183111070 22:35648899-35648921 AGCCCTCGGATCCCCAGCAGTGG - Intronic
1184667335 22:45995930-45995952 GGCCCACCGCTCCCTCGCCCTGG - Intergenic
1185203535 22:49523282-49523304 AGCCCACGGCCCCTTGGCCCAGG + Intronic
953875679 3:46665462-46665484 AGCCCACGGGTCAGTAGCCCGGG - Intergenic
954303321 3:49712848-49712870 AGCCAACAGCTCCCTAGCAAAGG + Intronic
956563675 3:70612142-70612164 AGCCCCCTGCTCCACAGCACCGG + Intergenic
957499145 3:81031688-81031710 AGCCCATTGCCCCCTAGCCCTGG + Intergenic
960753535 3:120982922-120982944 AGCCCACTCCTCCCTATCACAGG - Intronic
961407006 3:126686697-126686719 AGCCCACTGTTCCCTAACAAAGG + Intergenic
966947359 3:184786349-184786371 AGCCCTCGGCTCCATCCCACAGG - Intergenic
968462751 4:733435-733457 AGCCCCCGGCTCCCCCGCACTGG - Intronic
969114102 4:4860474-4860496 AGCCCACGGCTCCCTAGCACCGG - Intronic
969341835 4:6546957-6546979 AGCTAACGGCCCCCAAGCACAGG + Intronic
982199967 4:152950585-152950607 AGCCCACGGTGCCCCAACACAGG - Intronic
985631749 5:1017658-1017680 AGCCCACAGCCCCCCACCACGGG + Intronic
985663590 5:1169759-1169781 AGCCCAAGCCTGCCGAGCACGGG + Intergenic
986201666 5:5584820-5584842 AGCCCACGGCACCAGAGGACAGG - Intergenic
988688786 5:33550819-33550841 ACACCATGGATCCCTAGCACAGG + Intronic
991972825 5:72157518-72157540 AGCCCATGGCTCCCTGTCCCCGG - Intronic
992153871 5:73934956-73934978 AGGCCATGGCTCCCTAACAGTGG + Intronic
1003536629 6:6981214-6981236 AGGCCACGTCTCCCTCGCCCAGG + Intergenic
1006362532 6:33594816-33594838 AGCCAACGGCACCCTGGCAGTGG - Intergenic
1006682269 6:35805632-35805654 AGCCCACGGGACCCCAGCCCAGG + Exonic
1006844176 6:37051159-37051181 AGCACAGGGGTCCCTGGCACAGG - Intergenic
1019198904 6:170297685-170297707 GGCCAACAGCTCCCCAGCACGGG - Intronic
1024629782 7:51237673-51237695 GGCCCAAGGCACCCTAGCATGGG - Intronic
1025015600 7:55436562-55436584 AGCCCAGGGCTGCCAAGCAGAGG - Intronic
1029448789 7:100629206-100629228 GGCCCACCGCTGCCTAGCCCAGG + Intronic
1031887709 7:127258280-127258302 AGCCCAGTCCTCCCTATCACTGG + Intergenic
1034707525 7:153158840-153158862 AGCCCACAGCTCCCTAGGGGTGG - Intergenic
1039407992 8:37329166-37329188 AGCCCAGAGCTCCCTGCCACTGG + Intergenic
1040806101 8:51398113-51398135 AGCCCACAGCTTCCAAACACTGG + Intronic
1044860242 8:96515925-96515947 AACTTACGGCTCCCTAGCCCTGG + Intronic
1048967784 8:139626668-139626690 AGCCCACAGTTCCCTGGGACAGG + Intronic
1049592783 8:143470159-143470181 AGCCCAGTGCTCCCTAGCTAGGG + Intronic
1051291786 9:15552859-15552881 AGCCCGCCGCTCCCCAGCAACGG + Intergenic
1060667144 9:125438762-125438784 AGCCCCTGGCTCACTGGCACAGG - Exonic
1060705233 9:125792576-125792598 AAACCACTGCTCCCTATCACTGG - Intronic
1061908035 9:133708744-133708766 ACCCCAGGACTCCCCAGCACTGG - Intronic
1062562569 9:137148242-137148264 AGGCCAGGGCTCCCTAGCCGTGG - Intronic
1185793011 X:2941963-2941985 AGGCCACGTCTCACTAACACAGG + Intronic
1189367901 X:40403225-40403247 AGCCCTCAGCTCCTTAGCGCTGG - Intergenic
1191841901 X:65519239-65519261 CTCCCACGGCTCCTCAGCACAGG - Intronic
1191859784 X:65656852-65656874 CTCCCACGGCTCCTCAGCACAGG - Intronic
1194446497 X:93993901-93993923 AGCCCTCAGCTCCCTATCCCAGG + Intergenic
1198220882 X:134600606-134600628 AGCCCACCGCACTCTAGCATGGG + Intronic