ID: 969115661

View in Genome Browser
Species Human (GRCh38)
Location 4:4869274-4869296
Sequence TGCAACAAAGGCTGCCACGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969115661_969115666 5 Left 969115661 4:4869274-4869296 CCTACGTGGCAGCCTTTGTTGCA No data
Right 969115666 4:4869302-4869324 TACAGGCGAGGAGACAGTGGTGG No data
969115661_969115668 26 Left 969115661 4:4869274-4869296 CCTACGTGGCAGCCTTTGTTGCA No data
Right 969115668 4:4869323-4869345 GGGATCCAAGCCCGCTGCTGTGG No data
969115661_969115664 -7 Left 969115661 4:4869274-4869296 CCTACGTGGCAGCCTTTGTTGCA No data
Right 969115664 4:4869290-4869312 TGTTGCACATTTTACAGGCGAGG No data
969115661_969115667 6 Left 969115661 4:4869274-4869296 CCTACGTGGCAGCCTTTGTTGCA No data
Right 969115667 4:4869303-4869325 ACAGGCGAGGAGACAGTGGTGGG No data
969115661_969115665 2 Left 969115661 4:4869274-4869296 CCTACGTGGCAGCCTTTGTTGCA No data
Right 969115665 4:4869299-4869321 TTTTACAGGCGAGGAGACAGTGG No data
969115661_969115669 27 Left 969115661 4:4869274-4869296 CCTACGTGGCAGCCTTTGTTGCA No data
Right 969115669 4:4869324-4869346 GGATCCAAGCCCGCTGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969115661 Original CRISPR TGCAACAAAGGCTGCCACGT AGG (reversed) Intergenic