ID: 969115688

View in Genome Browser
Species Human (GRCh38)
Location 4:4869437-4869459
Sequence GGCGCTGCTGCCAGAGTTTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969115682_969115688 4 Left 969115682 4:4869410-4869432 CCTGACAGTGCGTGTGTGCGCCC No data
Right 969115688 4:4869437-4869459 GGCGCTGCTGCCAGAGTTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969115688 Original CRISPR GGCGCTGCTGCCAGAGTTTG CGG Intergenic
No off target data available for this crispr