ID: 969116385

View in Genome Browser
Species Human (GRCh38)
Location 4:4872970-4872992
Sequence GCCCTGGATTTCCTGACAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969116380_969116385 3 Left 969116380 4:4872944-4872966 CCACGTCCTTAATTTCCAGGAGG No data
Right 969116385 4:4872970-4872992 GCCCTGGATTTCCTGACAGCCGG No data
969116377_969116385 14 Left 969116377 4:4872933-4872955 CCATGCCTGAGCCACGTCCTTAA No data
Right 969116385 4:4872970-4872992 GCCCTGGATTTCCTGACAGCCGG No data
969116382_969116385 -3 Left 969116382 4:4872950-4872972 CCTTAATTTCCAGGAGGAGAGCC No data
Right 969116385 4:4872970-4872992 GCCCTGGATTTCCTGACAGCCGG No data
969116378_969116385 9 Left 969116378 4:4872938-4872960 CCTGAGCCACGTCCTTAATTTCC No data
Right 969116385 4:4872970-4872992 GCCCTGGATTTCCTGACAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969116385 Original CRISPR GCCCTGGATTTCCTGACAGC CGG Intergenic
No off target data available for this crispr