ID: 969117495

View in Genome Browser
Species Human (GRCh38)
Location 4:4880414-4880436
Sequence CTCTGTCAGAGGACGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969117495_969117500 -9 Left 969117495 4:4880414-4880436 CCCTCCACCGTCCTCTGACAGAG No data
Right 969117500 4:4880428-4880450 CTGACAGAGAGTCAAAGTCCTGG No data
969117495_969117501 -8 Left 969117495 4:4880414-4880436 CCCTCCACCGTCCTCTGACAGAG No data
Right 969117501 4:4880429-4880451 TGACAGAGAGTCAAAGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969117495 Original CRISPR CTCTGTCAGAGGACGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr