ID: 969117653

View in Genome Browser
Species Human (GRCh38)
Location 4:4881958-4881980
Sequence CTTGAGGGGCAGAGGGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969117653_969117659 12 Left 969117653 4:4881958-4881980 CCAGGTTCCCTCTGCCCCTCAAG No data
Right 969117659 4:4881993-4882015 GAATAAAATAGCACTTTCACAGG No data
969117653_969117660 18 Left 969117653 4:4881958-4881980 CCAGGTTCCCTCTGCCCCTCAAG No data
Right 969117660 4:4881999-4882021 AATAGCACTTTCACAGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969117653 Original CRISPR CTTGAGGGGCAGAGGGAACC TGG (reversed) Intergenic
No off target data available for this crispr