ID: 969118572

View in Genome Browser
Species Human (GRCh38)
Location 4:4889902-4889924
Sequence CCCTTGAGTGAGCGGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969118567_969118572 17 Left 969118567 4:4889862-4889884 CCATGTCTGTTTCTCAGACCTAC No data
Right 969118572 4:4889902-4889924 CCCTTGAGTGAGCGGATGGCAGG No data
969118568_969118572 -1 Left 969118568 4:4889880-4889902 CCTACTGAGTTCGCTGAGAAGAC No data
Right 969118572 4:4889902-4889924 CCCTTGAGTGAGCGGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969118572 Original CRISPR CCCTTGAGTGAGCGGATGGC AGG Intergenic
No off target data available for this crispr