ID: 969122403

View in Genome Browser
Species Human (GRCh38)
Location 4:4919895-4919917
Sequence CAGAGTGGGAAGCTCTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969122392_969122403 23 Left 969122392 4:4919849-4919871 CCACTTGCCACTCAGAGCTGTCC No data
Right 969122403 4:4919895-4919917 CAGAGTGGGAAGCTCTTGGAGGG No data
969122391_969122403 27 Left 969122391 4:4919845-4919867 CCTGCCACTTGCCACTCAGAGCT No data
Right 969122403 4:4919895-4919917 CAGAGTGGGAAGCTCTTGGAGGG No data
969122393_969122403 16 Left 969122393 4:4919856-4919878 CCACTCAGAGCTGTCCAGAGAGG No data
Right 969122403 4:4919895-4919917 CAGAGTGGGAAGCTCTTGGAGGG No data
969122395_969122403 2 Left 969122395 4:4919870-4919892 CCAGAGAGGACACACCAAGCACA No data
Right 969122403 4:4919895-4919917 CAGAGTGGGAAGCTCTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969122403 Original CRISPR CAGAGTGGGAAGCTCTTGGA GGG Intergenic
No off target data available for this crispr