ID: 969125790

View in Genome Browser
Species Human (GRCh38)
Location 4:4946844-4946866
Sequence ATGGAGATTCTGAAGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969125781_969125790 24 Left 969125781 4:4946797-4946819 CCCCTACTACTGGCACTCAAGTA No data
Right 969125790 4:4946844-4946866 ATGGAGATTCTGAAGCAGGATGG No data
969125782_969125790 23 Left 969125782 4:4946798-4946820 CCCTACTACTGGCACTCAAGTAA No data
Right 969125790 4:4946844-4946866 ATGGAGATTCTGAAGCAGGATGG No data
969125779_969125790 29 Left 969125779 4:4946792-4946814 CCCAGCCCCTACTACTGGCACTC No data
Right 969125790 4:4946844-4946866 ATGGAGATTCTGAAGCAGGATGG No data
969125780_969125790 28 Left 969125780 4:4946793-4946815 CCAGCCCCTACTACTGGCACTCA No data
Right 969125790 4:4946844-4946866 ATGGAGATTCTGAAGCAGGATGG No data
969125783_969125790 22 Left 969125783 4:4946799-4946821 CCTACTACTGGCACTCAAGTAAA No data
Right 969125790 4:4946844-4946866 ATGGAGATTCTGAAGCAGGATGG No data
969125787_969125790 -4 Left 969125787 4:4946825-4946847 CCATTTGGTCAGGAGGAGAATGG No data
Right 969125790 4:4946844-4946866 ATGGAGATTCTGAAGCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969125790 Original CRISPR ATGGAGATTCTGAAGCAGGA TGG Intergenic
No off target data available for this crispr