ID: 969129020

View in Genome Browser
Species Human (GRCh38)
Location 4:4977360-4977382
Sequence CTATGACAGCACATCTATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969129020_969129023 22 Left 969129020 4:4977360-4977382 CCCTGATAGATGTGCTGTCATAG No data
Right 969129023 4:4977405-4977427 GAGTCCCATGCAACTCCACTTGG No data
969129020_969129026 27 Left 969129020 4:4977360-4977382 CCCTGATAGATGTGCTGTCATAG No data
Right 969129026 4:4977410-4977432 CCATGCAACTCCACTTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969129020 Original CRISPR CTATGACAGCACATCTATCA GGG (reversed) Intergenic
No off target data available for this crispr