ID: 969129020 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:4977360-4977382 |
| Sequence | CTATGACAGCACATCTATCA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 969129020_969129023 | 22 | Left | 969129020 | 4:4977360-4977382 | CCCTGATAGATGTGCTGTCATAG | No data | ||
| Right | 969129023 | 4:4977405-4977427 | GAGTCCCATGCAACTCCACTTGG | No data | ||||
| 969129020_969129026 | 27 | Left | 969129020 | 4:4977360-4977382 | CCCTGATAGATGTGCTGTCATAG | No data | ||
| Right | 969129026 | 4:4977410-4977432 | CCATGCAACTCCACTTGGAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 969129020 | Original CRISPR | CTATGACAGCACATCTATCA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||