ID: 969129044

View in Genome Browser
Species Human (GRCh38)
Location 4:4977556-4977578
Sequence TGATTCACCAGGAGACTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969129044_969129049 -8 Left 969129044 4:4977556-4977578 CCTGTGAGTCTCCTGGTGAATCA No data
Right 969129049 4:4977571-4977593 GTGAATCATTAAACCTGGGGTGG No data
969129044_969129051 -1 Left 969129044 4:4977556-4977578 CCTGTGAGTCTCCTGGTGAATCA No data
Right 969129051 4:4977578-4977600 ATTAAACCTGGGGTGGTCTTGGG No data
969129044_969129055 29 Left 969129044 4:4977556-4977578 CCTGTGAGTCTCCTGGTGAATCA No data
Right 969129055 4:4977608-4977630 ACACACCCTTTCTCCTTCTCTGG No data
969129044_969129050 -2 Left 969129044 4:4977556-4977578 CCTGTGAGTCTCCTGGTGAATCA No data
Right 969129050 4:4977577-4977599 CATTAAACCTGGGGTGGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969129044 Original CRISPR TGATTCACCAGGAGACTCAC AGG (reversed) Intergenic
No off target data available for this crispr