ID: 969129461

View in Genome Browser
Species Human (GRCh38)
Location 4:4980983-4981005
Sequence GCCTTTATCACTGCACACAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969129461_969129464 3 Left 969129461 4:4980983-4981005 CCGCTGTGTGCAGTGATAAAGGC No data
Right 969129464 4:4981009-4981031 TCAGACGGTCTCACACAGCTGGG No data
969129461_969129468 29 Left 969129461 4:4980983-4981005 CCGCTGTGTGCAGTGATAAAGGC No data
Right 969129468 4:4981035-4981057 TCCAAGGGTATTATATTCTTTGG No data
969129461_969129465 4 Left 969129461 4:4980983-4981005 CCGCTGTGTGCAGTGATAAAGGC No data
Right 969129465 4:4981010-4981032 CAGACGGTCTCACACAGCTGGGG No data
969129461_969129466 13 Left 969129461 4:4980983-4981005 CCGCTGTGTGCAGTGATAAAGGC No data
Right 969129466 4:4981019-4981041 TCACACAGCTGGGGCATCCAAGG No data
969129461_969129463 2 Left 969129461 4:4980983-4981005 CCGCTGTGTGCAGTGATAAAGGC No data
Right 969129463 4:4981008-4981030 CTCAGACGGTCTCACACAGCTGG No data
969129461_969129467 14 Left 969129461 4:4980983-4981005 CCGCTGTGTGCAGTGATAAAGGC No data
Right 969129467 4:4981020-4981042 CACACAGCTGGGGCATCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969129461 Original CRISPR GCCTTTATCACTGCACACAG CGG (reversed) Intergenic
No off target data available for this crispr