ID: 969129467

View in Genome Browser
Species Human (GRCh38)
Location 4:4981020-4981042
Sequence CACACAGCTGGGGCATCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969129461_969129467 14 Left 969129461 4:4980983-4981005 CCGCTGTGTGCAGTGATAAAGGC No data
Right 969129467 4:4981020-4981042 CACACAGCTGGGGCATCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969129467 Original CRISPR CACACAGCTGGGGCATCCAA GGG Intergenic
No off target data available for this crispr