ID: 969131618

View in Genome Browser
Species Human (GRCh38)
Location 4:4994769-4994791
Sequence GACTCAGCTTTTCCTCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969131611_969131618 5 Left 969131611 4:4994741-4994763 CCTGTAGGATCCCAGAGGCCATA No data
Right 969131618 4:4994769-4994791 GACTCAGCTTTTCCTCCAGGTGG No data
969131615_969131618 -6 Left 969131615 4:4994752-4994774 CCAGAGGCCATAGCTGGGACTCA No data
Right 969131618 4:4994769-4994791 GACTCAGCTTTTCCTCCAGGTGG No data
969131606_969131618 28 Left 969131606 4:4994718-4994740 CCTGAGAGGTGACAGCCCAAAAT No data
Right 969131618 4:4994769-4994791 GACTCAGCTTTTCCTCCAGGTGG No data
969131609_969131618 12 Left 969131609 4:4994734-4994756 CCAAAATCCTGTAGGATCCCAGA No data
Right 969131618 4:4994769-4994791 GACTCAGCTTTTCCTCCAGGTGG No data
969131614_969131618 -5 Left 969131614 4:4994751-4994773 CCCAGAGGCCATAGCTGGGACTC No data
Right 969131618 4:4994769-4994791 GACTCAGCTTTTCCTCCAGGTGG No data
969131608_969131618 13 Left 969131608 4:4994733-4994755 CCCAAAATCCTGTAGGATCCCAG No data
Right 969131618 4:4994769-4994791 GACTCAGCTTTTCCTCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969131618 Original CRISPR GACTCAGCTTTTCCTCCAGG TGG Intergenic
No off target data available for this crispr