ID: 969132738

View in Genome Browser
Species Human (GRCh38)
Location 4:5003680-5003702
Sequence GGCTTATCAGCGATTTCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969132726_969132738 27 Left 969132726 4:5003630-5003652 CCCCTCCCAAGCCAGGCTGCAGT No data
Right 969132738 4:5003680-5003702 GGCTTATCAGCGATTTCAGGTGG No data
969132725_969132738 28 Left 969132725 4:5003629-5003651 CCCCCTCCCAAGCCAGGCTGCAG No data
Right 969132738 4:5003680-5003702 GGCTTATCAGCGATTTCAGGTGG No data
969132730_969132738 21 Left 969132730 4:5003636-5003658 CCAAGCCAGGCTGCAGTGCAAGA No data
Right 969132738 4:5003680-5003702 GGCTTATCAGCGATTTCAGGTGG No data
969132727_969132738 26 Left 969132727 4:5003631-5003653 CCCTCCCAAGCCAGGCTGCAGTG No data
Right 969132738 4:5003680-5003702 GGCTTATCAGCGATTTCAGGTGG No data
969132735_969132738 -6 Left 969132735 4:5003663-5003685 CCAGGCCAGATGTGAGAGGCTTA No data
Right 969132738 4:5003680-5003702 GGCTTATCAGCGATTTCAGGTGG No data
969132729_969132738 22 Left 969132729 4:5003635-5003657 CCCAAGCCAGGCTGCAGTGCAAG No data
Right 969132738 4:5003680-5003702 GGCTTATCAGCGATTTCAGGTGG No data
969132732_969132738 16 Left 969132732 4:5003641-5003663 CCAGGCTGCAGTGCAAGAGAGGC No data
Right 969132738 4:5003680-5003702 GGCTTATCAGCGATTTCAGGTGG No data
969132728_969132738 25 Left 969132728 4:5003632-5003654 CCTCCCAAGCCAGGCTGCAGTGC No data
Right 969132738 4:5003680-5003702 GGCTTATCAGCGATTTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969132738 Original CRISPR GGCTTATCAGCGATTTCAGG TGG Intergenic
No off target data available for this crispr