ID: 969137376

View in Genome Browser
Species Human (GRCh38)
Location 4:5040891-5040913
Sequence CCTAGGCAACTGTAACACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969137371_969137376 8 Left 969137371 4:5040860-5040882 CCTAGGCTACAAACCTGTGCAGC 0: 62
1: 553
2: 1242
3: 1455
4: 1306
Right 969137376 4:5040891-5040913 CCTAGGCAACTGTAACACATTGG No data
969137370_969137376 17 Left 969137370 4:5040851-5040873 CCAATAGCTCCTAGGCTACAAAC No data
Right 969137376 4:5040891-5040913 CCTAGGCAACTGTAACACATTGG No data
969137372_969137376 -5 Left 969137372 4:5040873-5040895 CCTGTGCAGCATGAATACCCTAG No data
Right 969137376 4:5040891-5040913 CCTAGGCAACTGTAACACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969137376 Original CRISPR CCTAGGCAACTGTAACACAT TGG Intergenic
No off target data available for this crispr